Next Article in Journal
Estimation and Mapping of Actual and Potential Grassland Root Carbon Storage: A Case Study in the Altay Region, China
Previous Article in Journal
Yield Predictions of Four Hybrids of Maize (Zea mays) Using Multispectral Images Obtained from UAV in the Coast of Peru
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 11
10.3390/agronomy12112631
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED

by
Dingyihui Lu
1,2,†,
Hao Yue
2,†,
Jianbin Chen
2,
Yan Wei
2,
Zhanhong Zhang
3,
Jun Zeng
4,
Zhuo Zhang
2,
Xuguo Zhou
5,
Limin Zheng
2,
Yang Gao
2,
Jing Peng
2,
Xiaobin Shi
1,2,
Yong Liu
2 and
Deyong Zhang
1,2,*
1
Subcollege of Longping, College of Biology, Graduate School of Hunan University, Changsha 410125, China
2
Institute of Plant Protection, Hunan Academy of Agricultural Sciences, Changsha 410125, China
3
Institute of Vegetable, Hunan Academy of Agricultural Sciences, Changsha 410125, China
4
Institute of Microbial Applications, Xinjiang Academy of Agricultural Sciences, Urumqi 830091, China
5
Department of Entomology, University of Kentucky, Lexington, KY 40546, USA
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2022, 12(11), 2631; https://doi.org/10.3390/agronomy12112631
Submission received: 20 September 2022 / Revised: 19 October 2022 / Accepted: 21 October 2022 / Published: 26 October 2022
(This article belongs to the Section Pest and Disease Management)
Browse Figures
Review Reports Versions Notes

Abstract

:
Tomato chlorosis virus (ToCV) is an RNA virus and a member of the Closteroviridae, Crinivirus, that is primarily vectored by Bemisia tabaci MED (B. tabaci MED). An outbreak of ToCV causes destructive damage to tomato plants and other solanaceous vegetables. Currently, ToCV has not been effectively controlled. Rhodopseudomonas palustris PSB-06 is a novel biological agent that is effective at controlling the tobacco mosaic virus (TMV). In this study, we investigated the role of PSB-06 in ToCV-infected tomato plants, and we studied the effects of PSB-06 on plant defense and plant photosynthetic pathways. Furthermore, the effect of PSB-06 on the acquisition and transmission of B. tabaci MED was determined. The results showed that compared with water-treated tomato plants, the contents of jasmonic acid increased, and the activities of catalase, peroxidase and superoxide dismutase increased significantly in tomato plants treated with PSB-06. The relative expression of genes involved in chlorophyll development, chlorophyll metabolism and photosynthesis also increased significantly. Simultaneously, treatment with PSB-06 reduced the acquisition and transmission of B. tabaci MED. We verified the hypothesis that PSB-06 is effective at controlling ToCV by promoting plant defense responses and reducing the amount of ToCV in tomato plants. We also confirmed the ability of B. tabaci MED to transmit ToCV. This study should help to control B. tabaci MED and reduce the spread of ToCV.

1. Introduction

Photosynthetic bacteria (PSB) are Gram-negative prokaryotes capable of photosynthesizing under anaerobic conditions. Based on whether they produce oxygen during the process of photosynthesis, PSB can be divided into oxygen-producing photosynthetic bacteria, such as cyanobacteria and protogreen bacteria, and non-oxygen-producing photosynthetic bacteria, such as purple bacteria and green bacteria [1,2]. In addition, photosynthetic bacteria can have a variety of metabolic modes, including photoautotrophy, photoheterotrophy, chemoautotrophy, and chemoheterotrophy, and have a strong ability to adapt to their environment [3]. Photosynthetic bacteria grow quickly and are non-toxic and rich in a variety of physiologically active substances, so they are widely used in sewage treatment, livestock and poultry breeding and aquaculture [4,5,6,7]. In addition, some studies have found that PSB GJ-22 can induce systemic resistance in plants [8,9]. The application of photosynthetic bacteria can increase the germination rate of seeds, promote plant growth and increase yields [10,11]. Basak et al. (2007) found that the fermentation broth of photosynthetic bacteria can reduce the amount of ammonia, nitrogen, and oxygen in water, thus improving the quality of aquatic products [12]. Su et al. (2017) found that Rhodopseudomonas palustris PSB-06 could effectively control TMV [13].
Tomato chlorosis virus (ToCV) is a Crinivirus (from the Closteroviridae family) with a genome of positive-sense single-stranded RNA [14]. Tomato plants and other economically important crops are affected by ToCV [15]. The virus was first discovered in Florida in the United States and then spread widely around the world [16,17,18,19,20]. ToCV cannot be transmitted by sap friction like other viruses; it can only be transmitted by insect vectors [21]. The main vector, the whitefly B. tabaci, transmits ToCV in a semipersistent manner [1,22]. Currently, there is no effective agent to control ToCV, and B. tabaci has been found to be resistant to a variety of insecticides [23].
Rhodopseudomonas palustris (R. palustris) has been reported to improve plant growth and substantially improve agricultural production [24,25,26]. A preliminary study found that photosynthetic bacteria-06 (PSB-06), a member of the purple nonsulfur bacteria can prevent and control ToCV in field experiments. Based on the effectiveness of control by PSB-06 in field experiments, we hypothesized that PSB-06 is effective at controlling infection with ToCV by promoting plant defense, reducing the amount of ToCV in tomato plants and reducing the efficiency of B. tabaci MED at transmitting ToCV. To verify this hypothesis, we first explored the content of ToCV to choose the optimal time to apply PSB-06. Secondly, we studied the effects of PSB-06 on plant defense pathways. Third, we studied the effects of PSB-06 on plant photosynthetic pathways. Finally, we investigated the indirect effect of PSB-06 on the acquisition and transmission of ToCV by B. tabaci MED. The results of this experiment will provide theoretical support and new ideas for the effective and green control of B. tabaci MED and ToCV.

2. Materials and Methods

2.1. Plants and Insects

Healthy B. tabaci MED and ToCV-infected B. tabaci MED colonies were established [27,28]. Healthy B. tabaci MED were maintained in whitefly-proof screen cages that contained healthy tomato plants, and infected B. tabaci MED were placed in whitefly-proof screen cages that contained ToCV-infected tomato plants. Tomato plants were maintained at a temperature of 26 ± 2 ℃ and 60 ± 10% humidity. To ensure that the colony remained infectious, biotype identification was performed every other month based on CAPS-PCR technology to amplify the mitochondrial cytochrome oxidase I gene (mt COI) [29] (Table 1).
Tomato plants (Solanum lycopersicum Mill. Cv. Zuanhongmeina) were cultured in a greenhouse with a temperature of 26 ± 2 °C, relative humidity of 60 ± 10%, and a photoperiod of L, 16 h: d 8 h [30]. The plants were not exposed to B. tabaci MED or pesticides and were placed in whitefly-proof screen cages [31]. After 40 days of growth, tomato seedlings were used for inoculation. ToCV-infected B. tabaci MED were collected and placed in clip-cages (50/cage), which were attached to healthy tomato plants at the three-true leaf stage. After an inoculation access period (IAP) of 48 h, the clip-cages were removed, and the tomato plants were grown without B. tabaci MED [32]. After 40 days, the new leaves of the tomato plants were collected and RT-PCR analysis was conducted using gene-specific primers of the ToCV heat shock protein 70 homolog (HSP70h) to detect whether they were infected with ToCV (Table 1) [33].
R. palustris PSB-06 (CCTCC NO: M2012518) was cultivated at the Hunan Plant Protection Institute (28°12′29.81″ N, 113°5′35.83″ E), Changsha, China [34].

2.2. Time of Application of PSB-06

The cultured PSB-06 (6.66 mg/L) used to treat the leaves of plants was sprayed every day, for 3 days, 5 days and 7 days. Simultaneously, the control group treated with water was used to treat the plants that had been subjected to the virus for 40 days. After 15 days, three-true leaves of the tomato plant were taken, and the content of ToCV of the tomato plants was detected by RT-qPCR. According to the DNA sequence of the HSP70 gene with ToCV-qF and ToCV-qR as primers (Table 1), target DNA fragments were cloned. When the positive clones were completely correct, plasmids were extracted with the TIANprep Mini Plasmid Kit (Tiangen Biotech Co., Ltd., Beijing, China). After this, their concentrations and OD values were determined with an ultraviolet spectrophotometer. Based on the following formula, the copy number was determined: Copy number (copies/μL) =
Nucleic   acid   concentration   ( g / μ L ) × 6.02 × 10 23 ( copies / moL ) 660 ( g / moL ) × Fragment   length ( bp )
Next, the copy number of plasmids was calculated. The plasmids were diluted with DNase/RNase-free water according to 10-times gradient dilution. Then the plasmids were analyzed by RT-qPCR referring to ChamQ Universal SYBR qPCR Master Mix Kit (Vazyme Biology Co., Ltd., Nanjing, China). Finally, the obtained Ct values were used to calculate the standard curve of ToCV. Based on the standard curve of ToCV, the content of ToCV in the tomato plants was calculated.
In addition, the expression of magnesium chelatase H subunit (CHLH) in the chlorophyll development pathway, STAYGREEN1 (SGR1) in the chlorophyll metabolic pathway and chlorophyll-a/b binding7 (Cab7) gene in the photosynthesis pathway were detected. The optimal treatment time was selected based on the relevant expression level, ToCV content and actual cost. The total RNA of the tomato plants was extracted using TRIzol (TransGen Biotech Co., Ltd., Beijing, China). The first chain of cDNA was synthesized using the manufacturer’s instructions for Hiscript® Ⅱ Q RT SuperMix for qPCR (+g DNA wiper) (Vazyme Biology Co., Ltd., Nanjing, China) [35]. ChamQ Universal SYBR qPCR Master Mix using Hiscript® Ⅱ Q RT SuperMix was used for qPCR (Vazyme Biology Co., Ltd., Nanjing, China) [36]. Each treatment was repeated six times.

2.3. Effect of PSB-06 on Plant Defense Pathways

2.3.1. Effects of PSB-06 on the SA and JA Pathways

After the tomato plants’ leaves were sprayed with PSB-06 solution every 5 days, three-true leaves of the tomato plants were collected on days 15, 30, 45 and 60 after treatment and quickly frozen with liquid nitrogen. A grinder (MM 400; Verder Shanghai Instruments and Equipment Co., Ltd., Shanghai, China) was used to grind the plant leaves (0.5 g) at a frequency of 30 Hz for 30 s and they were then transferred to 5 mL microtubules. A total of 3 mL 90% precooled methanol and ddH2O was added, and then the homogenate was centrifuged at 7500× g for 10 min. The supernatant was transferred to a new microtube, and the remaining particles were resuspended in 2 mL 100% methanol and vortexed before centrifugation at 7500× g for 10 min. The supernatant was mixed with the supernatant from the first centrifugation, dried under vacuum, and then dissolved in 1.5 mL 5% trichloroacetic acid [37]. After centrifugation, the supernatant was extracted again with the same volume of ethyl acetate and cyclohexane. The extract was dried, resuspended with 3 mL 70% methanol and loaded onto a C18 column for collection. After evaporation, 500 mL of acetonitrile was added and filtered through a 0.22-μm PTFE filter membrane. All samples were analyzed for SA and JA using HPLC (Agilent Technologies Inc., Santa Clara, CA, USA). Tomato plants treated with water were used as the control group. Each process was conducted in triplicate.

2.3.2. Effects of PSB-06 on the Activities of Enzymes Related to Plant Defense

After the ToCV-infected tomato plants’ leaves were sprayed with PSB-06 every 5 days, three-true leaves of tomato plants were collected after 45 days of treatment and tested for CAT, POD, and SOD activities (Solarbio Biology Co., Ltd., Beijing, China). Tomato plants treated with water were used as the control group. Each assay was repeated six times.

2.4. Effect of PSB-06 on Plant Photosynthesis-Related Pathways

2.4.1. Effects of PSB-06 on Plant Chlorophyll and Nitrogen Content

After the ToCV-infected tomato plants’ leaves were sprayed with PSB-06 every 5 days, the contents of chlorophyll and nitrogen of the three-true leaves of the tomato plants were measured using the OK-Y104 chlorophyll meter (Zhengzhou Okoqi Instrument Manufacturing Co., Ltd., Zhengzhou, China) on days 15, 30, 45, and 60 after treatment. Each treatment was conducted in triplicate.

2.4.2. Effects of PSB-06 on Chlorophyll Development, Chlorophyll Metabolism and the Photosynthetic Gene Expression in Plants

After the ToCV-infected tomato plants’ leaves were sprayed with PSB-06 for 5 days, three-true leaves of tomato plants were collected after 45 days. ACT and UBI were used as internal reference genes [37] (Table 1), and ChamQ Universal SYBR qPCR Master (Vazyme Biology Co., Ltd.) was used for fluorescence quantitative PCR. The expression of CHLH, Mg protoporphyrin IX methyltransferase (CHLM), and protoporphyllide reductase (POR) relating to the chlorophyll development pathway was monitored. The expression of pheophorbide a oxygenase (PAO), pheophytin pheophorbide hydrolase (PPH), and SGR1 related to the chlorophyll metabolic pathway and Cab7, light-harvesting chlorophyll-A1 (LHCA1), and the small subunit of RUBISCO (rbcS) related to photosynthesis was measured [38]. Each process was conducted in triplicate.

2.5. The Indirect Effects of PSB-06 on the Acquisition and Transmission of B. tabaci MED

2.5.1. The Effect of PSB-06 on the Acquisition of B. tabaci MED

Healthy B. tabaci MED were placed in clip-cages (50/cage) and starved for 2 h. The clip-cages were then attached to ToCV-infected tomato plants that had been sprayed with PSB-06 for 45 days. The content of ToCV obtained by B. tabaci MED was determined after an acquisition access period (AAP) of 48 h. Simultaneously, healthy B. tabaci MED were placed on the ToCV-infected tomato plants and the controls. Each process was repeated six times.

2.5.2. The Effect of PSB-06 on the Transmission of B. tabaci MED

After a 48 h AAP, B. tabaci MED was collected in clip-cages (50/cage), which were attached to healthy tomato plants (one plant/cage). After the 48 h inoculation access period (IAP), the clip-cages were removed, and the plants were grown normally. At 30, 45 and 60 days, the ToCV that had accumulated in tomato plants was measured. Each treatment was repeated six times.

2.6. Data Analysis

All of the data analyses were performed by SPSS Statistics 21.0 (SPSS Inc., Chicago, IL, USA). The relevant expression level and ToCV content to select the optimal treatment time were analyzed using a one-way ANOVA followed by the tests of Tukey at p < 0.05. Independent samples t-test was used to compare the effect of PSB-06 on the SA and JA pathways, chlorophyll development, chlorophyll metabolism and photosynthetic gene expression in plants, and the acquisition and transmission of ToCV by B. tabaci MED.

3. Results

3.1. Time of Application of PSB-06

The content of ToCV in tomato plants treated with PSB-06 once per day or once every 3 days, 5 days, or 7 days was significantly lower than that in tomato plants treated with water (the control) (Figure 1A; F1,6 = 28.129, p < 0.001). The relative levels of expression of CHLH, SGR1 and Cab7 in tomato plants treated with PSB-06 were significantly higher than those in the control (Figure 1B–D; F1,6 = 15.581, p < 0.001 for CHLH, F1,6 = 30.405, p < 0.001 for SGR1 and F1,6 = 56.872, p < 0.001 for Cab7). Simultaneously, the content of ToCV was the lowest in tomato plants treated with PSB-06 each day, and the relative expression of CHLH, SGR1 and Cab7 was the highest. Subsequently, the content of ToCV in tomato plants treated with PSB-06 every 3 days, 5 days, or 7 days increased gradually, while the relative levels of expression of CHLH, SGR1 and Cab7 decreased gradually. There was no significant difference between the tomato plants treated with PSB-06 every 5 days and 3 days. Therefore, to consider the cost and effectiveness, it is more suitable to use PSB-06 to treat the tomato plants every 5 days.

3.2. Effect of PSB-06 on Plant Defense Pathways

3.2.1. Effects of PSB-06 on the Salicylic Acid and Jasmonic Acid Pathways

After ToCV-infected tomato plants were treated with PSB-06 every 5 days, the content of jasmonic acid (JA) in the tomato plants increased gradually on days 15, 30, 45, and 60 (Figure 2A; F1,3 = 139.981, p < 0.001), while the content of salicylic acid (SA) did not change significantly (Figure 2B; F1,3 = 1.683, p = 0.119). The content of JA in the tomato plants treated with PSB-06 was higher than those of the control. Thus, PSB-06 treatment increased the content of JA in the tomato plants, which promoted the ability of the plants to defend.

3.2.2. Effects of PSB-06 on the Activities of Enzymes Related to Plant Defense

After the tomato plants were treated with PSB-06 every 5 days, the activities of catalase (CAT) (Figure 2C; F1,6 = 1.017, p < 0.05), peroxides (POD) (Figure 2D; F1,6 = 0.004, p < 0.01), and superoxide dismutase (SOD) (Figure 2E; F1,6 = 5.121, p < 0.05) increased significantly in the tomato plants on day 45.

3.3. Effect of PSB-06 on Plant Photosynthetic Pathways

3.3.1. Effects of PSB-06 on the Contents of Chlorophyll and Nitrogen

Compared with the control tomato plants (Figure 3A), treatment with PSB-06 alleviated the chlorotic symptoms of tomato leaves at 45 days (Figure 3B). After the tomato plants were treated with PSB-06 every 5 days, the contents of chlorophyll at days 15, and 45 were higher than that of the control group (Figure 3C; F1,3 = 2.575, p < 0.05), but the content of chlorophyll decreased gradually with time. Simultaneously, the nitrogen content of the tomato plants did not change significantly (Figure 3D; F1,3 = 0.400, p = 0.082).

3.3.2. Effects of PSB-06 on the Development of Chlorophyll, Chlorophyll Metabolism and the Photosynthetic Gene Expression in Plants

Compared with the control tomato plants, the relative expression of CHLH related to the chlorophyll development pathway of tomato plants increased significantly after the treatment with PSB-06 for 45 days (Figure 4A; F1, 3 = 3.284, p < 0.01). The relative expression of CHLM did not increase significantly (Figure 4B; F1,3 = 3.731, p = 0.087), and the relative expression of POR increased significantly (Figure 4C; F1,3 = 4.331, p < 0.01). The relative levels of expression of PAO, PPH and SGR1 related to the chlorophyll metabolic pathway increased significantly (Figure 4D–F; F1,3 = 5.206, p < 0.01 for PAO; F1,3 = 4.553, p < 0.01 for PPH; F1,3 = 2.896, p < 0.05 for SGR1); the levels of expression of Cab7, LHCA1 and rbcS related to photosynthesis also increased significantly (Figure 4G–I; F1,3 = 5.057, p < 0.01 for Cab7; F1,3 = 5.600, p < 0.01 for LHCA1; F1,3 = 9.029, p < 0.01 for rbcS).

3.4. The Indirect Effects of PSB-06 on the Acquisition and Transmission of ToCV by B. tabaci MED

3.4.1. The Effect of PSB-06 on the Acquisition of ToCV by B. tabaci MED

At 48 h AAP, the ToCV accumulation in the B. tabaci MED-fed ToCV-infected tomato plants that had been treated with PSB-06 was 1.66 × 106 copies/μL, and ToCV accumulation in the B. tabaci MED-fed ToCV-infected tomato plants that had been treated with water was 1.20 × 106 copies/μL, i.e., 30% lower than the former (Figure 5A; F1,6 = 4.270, p < 0.01).

3.4.2. The Effect of PSB-06 on the Transmission of B. tabaci MED

The content of ToCV in the tomato plants in the treatment group was lower than that in the control group. At 30 days IAP, the content of ToCV in the tomato plants exposed to ToCV-infected B. tabaci MED that had been treated with PSB-06 was 9.82 × 107 copies/μL, and the content of ToCV in the tomato plants exposed to ToCV-infected B. tabaci MED that had been treated with water was 6.37 × 107 copies/μL, i.e., 30% lower than the former (Figure 5B; F1,3 = 0.776, p < 0.001). At 60 days IAP, the content of ToCV in the tomato plants of PSB-06 treatment was 2.29 × 108 copies/μL, and the content of ToCV in the tomato plants of water treatment was 1.47 × 108 copies/μL, i.e., 35% lower than the former (Figure 5B; F1,3 = 0.005, p < 0.001). These results showed that PSB-06 treatment could indirectly inhibit the accumulation of ToCV in tomato plants.

4. Discussion

To date, there are no tomato varieties that are resistant to ToCV, and the control of ToCV primarily depends on the control of insect vectors by insecticides and the reduction of old plants and weeds infected with ToCV in and close to the cultivated area [22]. The main measure to control B. tabaci is the application of insecticides. Maluta et al. (2020) [39] found that flupyradifurone may decrease the survival of insects to potentially reduce the transmission of ToCV into tomato plants. Insecticides can reduce the spread of plant virus diseases by insect vectors [40,41]. Although insecticides are highly effective at inhibiting the transmission of viral diseases, there will be problems with resistance. Simultaneously, ToCV has a long incubation period of more than 20 days [42]. Thus, insecticides cannot kill viruliferous B. tabaci before they have transmitted the virus to plants [43]. In this study, we used PSB-06 to treat ToCV-infected tomato plants every 5 days for nine times, and the incidence of disease in the tomato plants decreased significantly. The accumulation of ToCV in the tomato plants exposed to B. tabaci also decreased significantly. The use of photosynthetic bacteria can reduce the insecticide resistance of B. tabaci to insecticides and achieve the purpose of a green and sustainable control of plant diseases [44].
Photosynthetic bacteria are widely used to improve water quality in aquaculture [45]. Fewer reports have focused on the use of photosynthetic bacteria to manage the transmission of viruses. In this study, the cultured PSB-06 (6.66 mg/L) were used to treat the plants every day, every 3 days, 5 days and 7 days. We found that there was no significant difference in the tomato plants treated with PSB-06 every 3 days and every 5 days. Therefore, to reduce the cost of treatment yet remain effective, it is more suitable to use PSB-06 to treat the tomato plants every 5 days. This will provide practical applications for the prevention and control of ToCV in the future.
Maurhofer et al. (1998) [46] revealed that Pseudomonas fluorescens strain P3 can express SA biosynthetic genes to improve resistance to the tobacco-to-tobacco necrosis virus. Amutharaj et al. (2013) [47] reported that P. fluorescens, which produces iron cells, can significantly increase the activity of POD of rice plants after treatment, thereby partially controlling rice blast (Magnaporthe grisea). The Bacillus amyloliquefaciens strain Bs006 and P. fluorescens strain Ps006 promoted growth, stress and defense [48]. Under the conditions of applying PSB-06, the activities of the antioxidant enzymes CAT, POD and SOD involved in the stress responses of tomatoes increased significantly, which indicated that treatment with PSB06 could improve the ability of tomato plants to resist stress. Li et al. (2014) [49] found that the suppression of JA led to the attraction of whiteflies. In this study, the content of JA in the tomato plants increased, inducing the JA pathway and causing the repulsion of whiteflies, which indirectly reduced the transmission of the virus.
Plant growth-promoting rhizobacteria (PGPR) can promote photosynthesis, and bacterial inoculation significantly, enhancing the concentration of chlorophyll [50]. P. fluorescens Sasm05 produces indole acetic acid (IAA) to promote plant growth and the concentration of leaf chlorophyll and enhance photosynthesis [51]. P. fluorescens N 21.4 increased photosynthesis and activated the expression of pathogenesis-related protein genes to promote plant immunity and improve plant fitness [52]. Meng et al. (2018) [53] reported that protochlorophyllide reductase (POR) and magnesium chelatase H subunit (CHLH) are important to the development and synthesis of chloroplasts in tomato fruit. Perveen et al. (2020) [54] found that the overexpression of mEmBP-1 led to an increase in the expression of light-harvesting chlorophyll-A (LHCA) and light-harvesting chlorophyll-B (LHCB) genes in photosynthesis, thereby increasing the photosynthesis and yield of rice fields. After applying PSB-06, the content of chlorophyll in the tomato plants increased, and the content of nitrogen also increased, which improved photosynthesis and significantly increased the expression of chlorophyll synthesis and photosynthetic genes. Under stress conditions, the accumulation of chlorophyll may activate the chlorophyll degradation pathway [38]. In this study, we also found that the chlorophyll synthesis of the tomato plants increased, and PSB-06 increased photosynthesis and activated the expression of pathogenesis to promote plant immunity and improve plant fitness. Thus, the attraction of the whiteflies to the tomato plants was reduced, which indirectly reduced the transmission of virus.
Su et al. (2017) [13] showed that R. palustris GJ-22 can promote resistance to plant viruses. After inoculation with GJ-22 in plants, the accumulation of TMV in tobacco decreased, but it is unclear whether it induces the mechanism of resistance to plant viruses in tobacco. The JSC-3b strain of R. palustris can inhibit TMV [25]. Streptomyces thermocarboxydus isolate BPSAC147 plays a significant role in plant growth to control Fusarium wilt disease and photosynthetic metabolism to enhance productivity [26]. In this study, after tomato plants were inoculated with R. palustris PSB-06, plant defense pathways were induced and photosynthesis was enhanced. In addition, the acquisition of ToCV and transmission of B. tabaci decreased. This is consistent with the findings of Koh et al. (2007) [24], that plants inoculated with photosynthetic bacteria can enhance photosynthesis, which acts as a biofertilizer to promote plant growth and inhibit pathogenic microorganisms, thus enhancing the resistance to plant disease. However, this study indicated the JA signaling pathways and processes relating to plant defense after using PSB-06 treatment, but the mechanism of action of R. palustris requires further analysis.

5. Conclusions

Currently, ToCV is found widely around the world. The management of the disease caused by ToCV has primarily focused on the reduction of whitefly populations using insecticides. However, the control of ToCV has presented some serious problems, such as insecticide resistance and environmental damage. The application of PSB-06 provides an efficient and environmentally friendly way to prevent and control ToCV. In this study, we verified that PSB-06 stimulated the plant defense and photosynthetic pathways of tomato plants, and the acquisition and transmission of B. tabaci MED were reduced, thereby alleviating the chlorotic symptoms of ToCV and reducing its transmission. This reduction helps to control B. tabaci MED and thus, the spread of ToCV.

Author Contributions

D.Z., X.S. and Y.L. conceived and designed the experiments; D.L. and H.Y. performed the experiments; D.L. analyzed the data; J.C., Y.W., Z.Z. (Zhanhong Zhang), J.Z., Z.Z. (Zhuo Zhang), X.Z., L.Z., Y.G. and J.P. contributed reagents, materials and analytical tools; D.L. and X.S. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (Nos. 32030088, 32072383, and 31972242), the Agriculture Research System of China (Nos. CARS-16-E-17, and CARS-23-D-02) and the Public Welfare Industry Research Project in Xinjiang Academy of Agricultural Sciences (KY2019022).

Data Availability Statement

Not applicable.

Acknowledgments

We thank Tao Zhou (China Agricultural University, Beijing, China) for providing the infectious cDNA clone of ToCV. The authors are also grateful to anonymous reviewers for their constructive comments and suggestions to improve this manuscript.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Qi, X.; Ren, Y.; Liang, P.; Wang, X. New insights in photosynthetic microbial fuel cell using anoxygenic phototrophic bacteria. Bioresour. Technol. 2018, 258, 310–317. [Google Scholar] [CrossRef] [PubMed]
  2. Gerhart, D. Forty-five years of developmental biology of photosynthetic bacteria. Photosynth. Res. 1996, 48, 325–352. [Google Scholar] [CrossRef] [PubMed]
  3. Gibson, J.; Stackebrandt, E.; Zablen, L.B.; Zablen, L.B.; Gupta, R.; Woese, C.R. A phylogenetic analysis of the purple photosynthetic bacteria. Curr. Microbiol. 1979, 3, 59–64. [Google Scholar] [CrossRef]
  4. Garcia-Chaves, M.C.; Cottrell, M.T.; Kirchman, D.L.; Ruiz-González, C.; Del Giorgio, P.A. Single-cell activity of freshwater aerobic anoxygenic phototrophic bacteria and their contribution to biomass production. ISME J. 2016, 10, 1579–1588. [Google Scholar] [CrossRef]
  5. Harada, N.; Nishiyama, M.; Otsuka, S.; Matsumoto, S. Effects of inoculation of phototrophic purple bacteria on grain yield of rice and nitrogenase activity of paddy soil in a pot experiment. Soil Sci. Plant Nutr. 2005, 51, 361–367. [Google Scholar] [CrossRef] [Green Version]
  6. Kobayashi, M.; Haque, M.Z. Contribution to nitrogen fixation and soil fertility by photosynthetic bacteria. Plant Soil 1971, 35, 443–456. [Google Scholar] [CrossRef]
  7. Cao, K.; Zhi, R.; Zhang, G. Photosynthetic bacteria wastewater treatment with the production of value-added products: A review. Bioresour. Technol. 2020, 299, 122648. [Google Scholar] [CrossRef] [PubMed]
  8. Zhai, Z.Y.; Du, J.; Chen, L.J.; Hamid, M.R.; Du, X.H.; Kong, X.T.; Cheng, J.; Tang, W.; Zhang, D.Y.; Su, P.; et al. A genetic tool for production of GFP-expressing Rhodopseudomonas palustris for visualization of bacterial colonization. AMB Express 2019, 9, 141. [Google Scholar] [CrossRef]
  9. Su, P.; Zhang, D.Y.; Zhang, Z.; Chen, A.; Hamid, M.R.; Li, C.G.; Du, J.; Cheng, J.E.; Tan, X.Q.; Zhen, L.M.; et al. Characterization of Rhodopseudomonas palustris population dynamics on tobacco phyllosphere and induction of plant resistance to Tobacco mosaic virus. Microb. Biotechnol. 2019, 12, 1453–1463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Lakshmi, C.V.; Kumar, M.; Khanna, S. Biodegradation of chlorpyrifos in soil by enriched cultures. Curr. Microbiol. 2009, 58, 35–38. [Google Scholar] [CrossRef] [PubMed]
  11. Tallur, P.N.; Megadi, V.B.; Ninnekar, H.Z. Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1. Biodegradation 2008, 19, 77. [Google Scholar] [CrossRef] [PubMed]
  12. Basak, N.; Das, D. The prospect of purple Non-Sulfur (PNS) photosynthetic bacteria for hydrogen production: The present state of the Art. World J. Microbiol. Biotechnol. 2007, 23, 31–42. [Google Scholar] [CrossRef]
  13. Su, P.; Tan, X.Q.; Li, C.G.; Zhang, D.Y.; Cheng, J.E.; Zhang, S.B.; Zhou, X.G.; Yan, Q.P.; Peng, J.; Zhang, Z.; et al. Photosynthetic bacterium Rhodopseudomonas palustris GJ-22 induces systemic resistance against viruses. Microb. Biotechnol. 2017, 10, 612–624. [Google Scholar] [CrossRef]
  14. Wintermantel, W.M.; Wisler, G.C. Vector specificity, host range, and genetic diversity of Tomato chlorosis virus. Plant Dis. 2006, 90, 814–819. [Google Scholar] [CrossRef] [Green Version]
  15. Fiallo-Olivé, E.; Navas-Castillo, J. Tomato chlorosis virus, an emergent plant virus still expanding its geographical and host ranges. Mol. Plant Pathol. 2019, 20, 1307–1320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Arruabarrena, A.; Rubio, L.; Gonzales-Arcos, M.; Maeso, D.; Fonseca, M.E.N.; Boiteux, L.S. First report of Tomato chlorosis virus infecting tomato crops in Uruguay. Plant Dis. 2014, 98, 1445. [Google Scholar] [CrossRef]
  17. Vargas, J.A.; Hammond, R.; Hernandez, E.; Barboza, N.; Mora, F.; Ramirez, P. First report of Tomato chlorosis virus infecting sweet pepper in Costa Rica. Plant Dis. 2011, 95, 1482. [Google Scholar] [CrossRef] [PubMed]
  18. Fiallo-olive, E.; Hamed, A.A.; Moriones, E.; Navas-Castillo, J. First report of Tomato chlorosis virus infecting tomato in Sudan. Plant Dis. 2011, 95, 1592. [Google Scholar] [CrossRef] [PubMed]
  19. Hirota, T.; Natsuaki, T.; Murai, T.; Nishigawa, H.; Niibori, K.; Goto, K.; Hartono, S.; Suastika, G.; Okuda, S. Yellowing disease of tomato caused by Tomato chlorosis virus newly recognized in Japan. J. Gen. Plant Pathol. 2010, 76, 168–171. [Google Scholar] [CrossRef]
  20. Dalmon, A.; Bouyer, S.; Cailly, M.; Girard, M.; Lecoq, H.; Desbiez, C.; Jacquemond, M. First report of Tomato chlorosis virus and Tomato infectious chlorosis virus in tomato crops in France. Plant Dis. 2005, 89, 1243. [Google Scholar] [CrossRef]
  21. Gilbertson, R.L.; Batuman, O.; Webster, C.G.; Adkins, S. Role of the insect supervectors Bemisia tabaci and Frankliniella occidentalis in the emergence and global spread of plant viruses. Annu. Rev. Virol. 2015, 2, 67–93. [Google Scholar] [CrossRef] [PubMed]
  22. Fortes, I.M.; Fernández-Muñoz, R.; Moriones, E. Host Plant Resistance to Bemisia tabaci to control damage caused in tomato plants by the emerging crinivirus Tomato chlorosis virus. Front. Plant Sci. 2020, 11, 585510. [Google Scholar] [CrossRef]
  23. Orfanidou, C.G.; Pappi, P.G.; Efthimiou, K.E.; Katis, N.I.; Maliogka, V.I. Transmission of Tomato chlorosis virus (ToCV) by Bemisia tabaci biotype Q and evaluation of four weed species as viral sources. Plant Dis. 2016, 100, 2043–2049. [Google Scholar] [CrossRef] [Green Version]
  24. Koh, R.H.; Song, H.G. Effects of application of Rhodopseudomonas sp. on seed germination and growth of tomato under axenic conditions. J. Microbiol. Biotechnol. 2007, 17, 1805–1810. [Google Scholar] [PubMed]
  25. Su, P.; Feng, T.Z.; Zhou, X.G.; Zhang, S.B.; Zhang, Y.; Cheng, J.; Luo, Y.H.; Peng, J.; Zhang, Z.; Lu, X.Y.; et al. Isolation of Rhp-PSP, a member of YER057c/YjgF/UK114 protein family with antiviral properties, from the photosynthetic bacterium Rhodopseudomonas palustris strain JSC-3b. Sci. Rep. 2015, 4, 16121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Lee, K.H.; Koh, R.H.; Song, H.G. Enhancement of growth and yield of tomato by Rhodopseudomonas sp. under greenhouse conditions. J. Microbiol. 2008, 46, 641–646. [Google Scholar] [CrossRef] [PubMed]
  27. Shi, X.; Pan, H.; Xie, W.; Wu, Q.; Wang, S.; Liu, Y.; Fang, Y.; Chen, G.; Gao, X.W.; Zhang, Y.J. Plant virus differentially alters the plant’s defense response to its closely related vectors. PLoS ONE 2013, 8, e83520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  28. Shi, X.B.; Chen, G.; Pan, H.P.; Xie, W.; Wu, Q.J.; Wang, S.L.; Liu, Y.; Zhou, X.G.; Zhang, Y.J. Plants pre-infested with viruliferous MED/Q cryptic species promotes subsequent bemisia tabaci infestation. Front. Microbiol. 2018, 9, 1404. [Google Scholar] [CrossRef] [Green Version]
  29. Chu, D.; Wan, F.H.; Zhang, Y.J.; Brown, J.K. Change in the biotype composition of Bemisia tabaci in Shandong province of China from 2005 to 2008. Environ. Entomol. 2010, 39, 1028–1036. [Google Scholar] [CrossRef]
  30. Tang, X.; Shi, X.B.; Zhang, D.Y.; Li, F.; Yan, F.; Zhang, Y.J.; Liu, Y.; Zhou, X.G. Detection and epidemic dynamic of ToCV and CCYV with MED and weed in Hainan of China. Virol. J. 2017, 14, 169. [Google Scholar] [CrossRef]
  31. Shi, X.B.; Tang, X.; Zhang, X.; Zhang, D.Y.; Li, F.; Yan, F.; Zhang, Y.J.; Zhou, X.G.; Liu, Y. Transmission efficiency, preference and behavior of Bemisia tabaci MEAM1 and MED under the influence of Tomato chlorosis virus. Front. Plant Sci. 2017, 8, 2271. [Google Scholar] [CrossRef] [Green Version]
  32. Shi, X.B.; Wang, X.Z.; Zhang, D.Y.; Zhang, Z.H.; Zhang, Z.; Cheng, J.; Zheng, L.M.; Zhou, X.G.; Tan, X.Q.; Liu, Y. Silencing of odorant-binding protein gene OBP3 using RNA interference reduced virus transmission of Tomato chlorosis virus. Int. J. Mol. Sci. 2019, 20, 4969. [Google Scholar] [CrossRef] [Green Version]
  33. Lett, J.M.; Hoareau, M.; Reynaud, B.; Saison, A.; Hostachy, B.; Lobin, K.; Benimadhu, S.P. First report of Tomato chlorosis virus in tomato on Mauritius island. Plant Dis. 2009, 93, 111. [Google Scholar] [CrossRef]
  34. Luo, L.Y.; Wang, P.; Zhai, Z.Y.; Su, P.; Tan, X.Q.; Zhang, D.Y.; Zhang, Z.; Liu, Y. The effects of Rhodopseudomonas palustris PSB06 and CGA009 with different agricultural applications on rice growth and rhizosphere bacterial communities. AMB Express 2019, 9, 173. [Google Scholar] [CrossRef]
  35. Fiallo, O.E.; Espino, A.I.; Botella, G.M.; Gómez, G.E.; Reyes, C.J.A.; Navas, C.J. Tobacco: A new natural host of Tomato chlorosis virus in Spain. Plant Dis. 2014, 98, 1162. [Google Scholar] [CrossRef]
  36. Pentzold, S.; Jensen, M.K.; Matthes, A.; Olsen, C.E.; Petersen, B.L.; Clausen, H.; Moller, B.L.; Bak, S.; Zagrobelny, M. Spatial separation of the cyanogenic β-glucosidase ZfBGD2 and cyanogenic glucosides in the haemolymph of Zygaena larvae facilitates cyanide release. R. Soc. Opensci 2017, 4, 170262. [Google Scholar] [CrossRef] [Green Version]
  37. Mascia, T.; Santovito, E.; Gallitelli, D.; Cillo, F. Evaluation of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010, 11, 805–816. [Google Scholar] [CrossRef]
  38. Zhou, S.; Cheng, X.; Li, F.; Feng, P.; Hu, G.; Chen, G.; Xie, Q.; Hu, Z. Overexpression of SlOFP20 in tomato affects plant growth, chlorophyll accumulation, and leaf senescence. Front. Plant Sci. 2019, 29, 1510. [Google Scholar]
  39. Maluta, N.K.P.; Lopes, J.R.S.; Fiallo-Olive, E.; Navas-Castillo, J.; Lourencao, A.L. Foliar spraying of tomato plants with systemic insecticides: Effects on feeding behavior, mortality and oviposition of Bemisia tabaci (Hemiptera: Aleyrodidae) and inoculation efficiency of Tomato chlorosis virus. Insects 2020, 11, 559. [Google Scholar]
  40. Carmo-Sousa, M.; Garcia, R.B.; Wulff, N.A.; Fereres, A.; Miranda, M.P. Drench application of systemic insecticides disrupts probing behavior of Diaphorina citri (Hemiptera: Liviidae) and inoculation of Candidatus Liberibacter asiaticus. Insects 2020, 11, 314. [Google Scholar]
  41. Castle, S.; Palumbo, J.; Merten, P.; Cowden, C.; Prabhaker, N. Effects of foliar and systemic insecticides on whitefly transmission and incidence of Cucurbit yellow stunting disorder virus. Pest. Manag. Sci. 2017, 73, 1462–1471. [Google Scholar] [CrossRef] [PubMed]
  42. Favara, G.M.; Bampi, D.; Molina, J.P.E.; Rezende, J.A.M. Kinetics of Systemic Invasion and Latent and Incubation Periods of Tomato severe rugose virus and Tomato chlorosis virus in Single and Co-Infections in Tomato Plants. Phytopathology 2019, 109, 480–487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Esquivel-Farina, A.; Rezende, J.A.M.; Wintermantel, W.M.; Hladky, L.J.; Bampi, D. Tomato chlorosis virus natural infection rate of known-susceptible hosts and the influence of the host plant on the virus relationship with MEAM1. Plant. Dis. 2021, 105, 1390–1397. [Google Scholar] [CrossRef] [PubMed]
  44. Grayer, R.J.; Kokubun, T. ChemInform abstract: Plant-fungal interactions: The search for phytoalexins and other antifungal compounds from higher plants. Phytochemistry 2001, 56, 253–263. [Google Scholar] [CrossRef]
  45. Zhang, P.; Sun, F.F.; Cheng, X.; Li, X.J.; Mu, H.B.; Wang, S.C.; Geng, H.L.; Duan, J.Y. Preparation and biological activities of an extracellular polysaccharide from Rhodopseudomonas palustris. Int. J. Biol. Macromol. 2019, 131, 933–940. [Google Scholar] [CrossRef]
  46. Maurhofer, M.; Reimmann, C.; Schmidli-Sacherer, P.; Heeb, S.; Haas, D.; Defago, G. Salicylic acid biosynthetic genes expressed in Pseudomonas fluorescens strain P3 improve the induction of systemic resistance in tobacco against Tobacco necrosis virus. Phytopathology 1998, 88, 678–684. [Google Scholar] [CrossRef] [Green Version]
  47. Amutharaj, P.; Sekar, C.; Natheer, S.E. Development and use of different formulations of Pseudomonas fluorescens siderophore for the enhancement of plant growth and induction of systemic resistance against Pyricularia Oryzae in lowland rice. Int. J. Pharm. Bio. Sci. 2013, 4, B831–B838. [Google Scholar]
  48. Gamez, R.M.; Rodriguez, F.; Vidal, N.M.; Ramirez, S.; Vera Alvarez, R.; Landsman, D.; Marino-Ramírez, L. Banana (Musa acuminata) transcriptome profiling in response to rhizobacteria: Bacillus amyloliquefaciens Bs006 and Pseudomonas fluorescens Ps006. BMC Genom. 2019, 20, 378. [Google Scholar] [CrossRef] [Green Version]
  49. Li, R.; Weldegergis, B.T.; Li, J.; Jung, C.; Qu, J.; Sun, Y.; Qian, H.; Tee, C.; van Loon, J.J.; Dicke, M.; et al. Virulence factors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance. Plant Cell 2014, 26, 4991–5008. [Google Scholar] [CrossRef] [Green Version]
  50. Wu, Y.J.; Ma, L.Y.; Liu, Q.Z.; Sikder, M.M.; Vestergard, M.; Zhou, K.Y.; Wang, Q.; Yang, X.E.; Feng, Y. Pseudomonas fluorescens promote photosynthesis, carbon fixation and cadmium phytoremediation of hyperaccumulator Sedum alfredii. Sci. Total Environ. 2020, 726, 138554. [Google Scholar]
  51. Chen, B.; Luo, S.; Wu, Y.; Ye, J.; Wang, Q.; Xu, X.; Pan, F.; Khan, K.Y.; Feng, Y.; Yang, X. The effects of the endophytic bacterium pseudomonas fluorescens Sasm05 and IAA on the plant growth and cadmium uptake of sedum alfredii hance. Front. Microbiol. 2017, 8, 2538. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Martin-Rivilla, H.; Garcia-Villaraco, A.; Ramos-Solano, B.; Gutierrez-Manero, F.J.; Lucas, J.A. Improving flavonoid metabolism in blackberry leaves and plant fitness by using the bioeffector Pseudomonas fluorescens N 21.4 and its metabolic elicitors: A biotechnological approach for a more sustainable crop. J. Agric. Food Chem. 2020, 68, 6170–6180. [Google Scholar] [CrossRef] [PubMed]
  53. Meng, L.; Fan, Z.; Zhang, Q.; Wang, C.; Gao, Y.; Deng, Y.; Zhu, B.; Zhu, H.; Chen, J.; Shan, W.; et al. BEL1-LIKE HOMEODOMAIN 11 regulates chloroplast development and chlorophyll synthesis in tomato fruit. Plant J. 2018, 94, 1126–1140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Perveen, S.; Qu, M.; Chen, F.; Essemine, J.; Khan, N.; Lyu, M.A.; Chang, T.; Song, Q.; Chen, G.Y.; Zhu, X.G. Overexpression of maize transcription factor mEmBP-1 increases photosynthesis, biomass, and yield in rice. J. Exp. Bot. 2020, 71, 4944–4957. [Google Scholar] [CrossRef]
Agronomy 12 02631 g001 550
Figure 1. Gene expression in tomato plants after spraying PSB-06 at different times. ToCV accumulation in tomato plants (A). The relative expression of CHLH in the pathways of chlorophyll development (B). The relative expression of SGR1 in the chlorophyll metabolic pathway (C). The relative expression of Cab7 in photosynthesis (D). The X-axis indicates the different situations that the tomato plants were treated. CK: The tomato plants treated with water. 1: The tomato plants treated with PSB-06 daily. 3: The tomato plants treated PSB-06 every 3 days. 5: The tomato plants treated PSB-06 every 5 days. 7: The tomato plants treated PSB-06 every 7 days. Data are the means ± SE. Different letters on the bars indicate the significant difference (p < 0.05). * p < 0.05; ns, not significant. SE, standard error; ToCV, Tomato chlorosis virus.
Figure 1. Gene expression in tomato plants after spraying PSB-06 at different times. ToCV accumulation in tomato plants (A). The relative expression of CHLH in the pathways of chlorophyll development (B). The relative expression of SGR1 in the chlorophyll metabolic pathway (C). The relative expression of Cab7 in photosynthesis (D). The X-axis indicates the different situations that the tomato plants were treated. CK: The tomato plants treated with water. 1: The tomato plants treated with PSB-06 daily. 3: The tomato plants treated PSB-06 every 3 days. 5: The tomato plants treated PSB-06 every 5 days. 7: The tomato plants treated PSB-06 every 7 days. Data are the means ± SE. Different letters on the bars indicate the significant difference (p < 0.05). * p < 0.05; ns, not significant. SE, standard error; ToCV, Tomato chlorosis virus.
Agronomy 12 02631 g001
Agronomy 12 02631 g002 550
Figure 2. Effect of PSB-06 on plant defense pathways. The content of jasmonic acid (ng/g) in tomato plants at 15, 30, 45, and 60 days (A). The content of salicylic acid (ng/g) in tomato plants at 15, 30, 45, and 60 days (B). The activity of catalase in tomato plants following treatments of PSB-06 for 45 days (C). The activity of peroxidase in tomato plants (D). The activity of superoxide dismutase in tomato plants (E). CK: The tomato plants treated with water. PSB-06: The tomato plants treated with PSB-06. Data are the mean ± SE; ** p < 0.01; * p < 0.05; ns: Not Significant. SE, standard error; PSB-06, photosynthetic bacteria-06.
Figure 2. Effect of PSB-06 on plant defense pathways. The content of jasmonic acid (ng/g) in tomato plants at 15, 30, 45, and 60 days (A). The content of salicylic acid (ng/g) in tomato plants at 15, 30, 45, and 60 days (B). The activity of catalase in tomato plants following treatments of PSB-06 for 45 days (C). The activity of peroxidase in tomato plants (D). The activity of superoxide dismutase in tomato plants (E). CK: The tomato plants treated with water. PSB-06: The tomato plants treated with PSB-06. Data are the mean ± SE; ** p < 0.01; * p < 0.05; ns: Not Significant. SE, standard error; PSB-06, photosynthetic bacteria-06.
Agronomy 12 02631 g002
Agronomy 12 02631 g003 550
Figure 3. Effect of PSB-06 on plant photosynthesis-related pathways. ToCV-infected tomato plants treated with water after 45 days (A). ToCV-infected tomato plants treated with PSB-06 after 45 days (B). The content of chlorophyll (SPAD) in the tomato plants (C). The content of nitrogen (mg/g) in the tomato plants (D). The X-axis indicates the number (15, 30, 45, 60) of days that the tomato plants were treated. Data are the mean ± SE, and different letters on the bars indicate significant differences. * p < 0.05; ns, not significant. SE, standard error; ToCV, tomato chlorosis virus.
Figure 3. Effect of PSB-06 on plant photosynthesis-related pathways. ToCV-infected tomato plants treated with water after 45 days (A). ToCV-infected tomato plants treated with PSB-06 after 45 days (B). The content of chlorophyll (SPAD) in the tomato plants (C). The content of nitrogen (mg/g) in the tomato plants (D). The X-axis indicates the number (15, 30, 45, 60) of days that the tomato plants were treated. Data are the mean ± SE, and different letters on the bars indicate significant differences. * p < 0.05; ns, not significant. SE, standard error; ToCV, tomato chlorosis virus.
Agronomy 12 02631 g003
Agronomy 12 02631 g004 550
Figure 4. Treatments of PSB-06 affected the development of chlorophyll and the genes relating to chlorophyll metabolism and photosynthesis in tomato plants after 45 days. The relative expression of CHLH, CHLM and POR in the chlorophyll development pathway (A–C). The relative expression of PAO, PPH and SGR1 in the chlorophyll metabolic pathway (D–F). The relative expression of Cab7, LHCA1 and rbcS in the photosynthetic pathway (G–I). CK: The tomato plants treated with water. PSB-06: The tomato plants treated with PSB-06. Data are the mean ± SE, Different letters on the bars indicate significant differences. ** p < 0.01; * p < 0.05; ns, not significant. SE, standard error.
Figure 4. Treatments of PSB-06 affected the development of chlorophyll and the genes relating to chlorophyll metabolism and photosynthesis in tomato plants after 45 days. The relative expression of CHLH, CHLM and POR in the chlorophyll development pathway (A–C). The relative expression of PAO, PPH and SGR1 in the chlorophyll metabolic pathway (D–F). The relative expression of Cab7, LHCA1 and rbcS in the photosynthetic pathway (G–I). CK: The tomato plants treated with water. PSB-06: The tomato plants treated with PSB-06. Data are the mean ± SE, Different letters on the bars indicate significant differences. ** p < 0.01; * p < 0.05; ns, not significant. SE, standard error.
Agronomy 12 02631 g004
Agronomy 12 02631 g005 550
Figure 5. The effect of PSB-06 treatment on the acquisition and transmission of ToCV by B. tabaci MED. The acquisition of ToCV by B. tabaci MED at 48 AAP (A). The content of ToCV in the tomato plants exposed to ToCV-infected B. tabaci MED (B). In (B), X-axis indicates the number (30, 45, 60) of days that the tomato plants had been infested when ToCV accumulation was determined. CK: The tomato plants treated with water. PSB-06: The tomato plants treated with PSB-06. Data are the mean ± SE, Different letters on the bars indicate significant differences. *** p < 0.001; ** p < 0.01. SE, standard error.
Figure 5. The effect of PSB-06 treatment on the acquisition and transmission of ToCV by B. tabaci MED. The acquisition of ToCV by B. tabaci MED at 48 AAP (A). The content of ToCV in the tomato plants exposed to ToCV-infected B. tabaci MED (B). In (B), X-axis indicates the number (30, 45, 60) of days that the tomato plants had been infested when ToCV accumulation was determined. CK: The tomato plants treated with water. PSB-06: The tomato plants treated with PSB-06. Data are the mean ± SE, Different letters on the bars indicate significant differences. *** p < 0.001; ** p < 0.01. SE, standard error.
Agronomy 12 02631 g005
Table
Table 1. Primer pairs.
Table 1. Primer pairs.
GeneDescriptionPrimer Sequence (5′-3′)
mt COIamplification of mt COIF: CTGAATATCGRCGAGGCATTCC
R: TTGATTTTTTGGTCATCCAGAAGT
HSP70hToCV RT-PCRF: GGTTTGGATTTTGGTACTACATTCAGT
R: AAACTGCCTGCATGAAAAGTCTC
ToCV-qToCV qPCRF: TTGTTCCTCTTTGGGTTTC
R: CGAATCTCCCTGGGTATC
ACTtomato plant reference geneF: AGGCAGGATTTGCTGGTGATGATGCT
R: ATACGCATCCTTCTGTCCCATTCCGA
UBItomato plant reference geneF: TCGTAAGGAGTGCCCTAATGCTGA
R: CAATCGCCTCCAGCCTTGTTGTAA
ActinB. tabaci reference geneF: CGCTGCCTCCACCTCATT
R: ACCGCAAGATTCCATACCC
EF-1αB. tabaci reference geneF: TAGCCTTGTGCCAATTTCCG
R: CCTTCAGCATTACCGTCC
CHLHqPCRF: GCTTTGGACCCACAGGCTAT
R: CTGTGCCAACGACTCTCCAT
CHLMqPCRF: AAGAAGGTGCCATTGTATCAG
R: CCATCCAAACTCTCCAAGTC
PORqPCRF: GCATCACATTTGCCTCCCTA
R: GAGTTCTTGTTCCAGCTCCAGTAC
PAOqPCRF: CGAAATTGGCTTAGACGGCAT
R: ATCTGTCCATCATCTGGCGTT
PPHqPCRF: TGAGGTAACAGAACACCCTGC
R: TCATTCGACACCCAGTCAGTG
SGR1qPCRF: ACTAGAAGGAAATGCAAGAAGAATCA
R: GCAACTTTCCTGGATGCTTTTC
Cab7qPCRF: TAGACTTGCTATGTTAGCCGTTATG
R: TTCTGCTTCTCACTTGGGACTG
rbcSqPCRF: TGCTCAGCGAAATTGAGTACCTAT
R: AACTTCCACATGGTCCAGTATCTG
LHCA1qPCRF: GATGCCGGTCTACGTTGGAG
R: AATCCAAAATCTCCGGGGGC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lu, D.; Yue, H.; Chen, J.; Wei, Y.; Zhang, Z.; Zeng, J.; Zhang, Z.; Zhou, X.; Zheng, L.; Gao, Y.; et al. Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED. Agronomy 2022, 12, 2631. https://doi.org/10.3390/agronomy12112631

AMA Style

Lu D, Yue H, Chen J, Wei Y, Zhang Z, Zeng J, Zhang Z, Zhou X, Zheng L, Gao Y, et al. Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED. Agronomy. 2022; 12(11):2631. https://doi.org/10.3390/agronomy12112631

Chicago/Turabian Style

Lu, Dingyihui, Hao Yue, Jianbin Chen, Yan Wei, Zhanhong Zhang, Jun Zeng, Zhuo Zhang, Xuguo Zhou, Limin Zheng, Yang Gao, and et al. 2022. "Rhodopseudomonas palustris PSB-06 Induces Plant Defense and Suppresses the Transmission of Tomato Chlorosis Virus by Bemisia tabaci MED" Agronomy 12, no. 11: 2631. https://doi.org/10.3390/agronomy12112631

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop