Abstract: No current screening methods for high‐grade ovarian cancer (HGOC) guarantee effective early detection for high‐risk women such as germline BRCA mutation carriers. Therefore, the standard‐of‐care remains risk‐reducing salpingo‐oophorectomy (RRSO) around age 40. Proximal liquid biopsy is a promising source of biomarkers, but sensitivity has not yet qualified for clinical implementation. We aimed to develop a proteomic assay based on proximal liquid biopsy, as a decision support tool for monitoring high‐risk population. Ninety Israeli BRCA1 or BRCA2 mutation carriers were included in the training set (17 HGOC patients and 73 asymptomatic women), (BEDOCA trial; ClinicalTrials.gov Identifier: NCT03150121). The proteome of the microvesicle fraction of the samples was profiled by mass spectrometry and a classifier was developed using logistic regression. An independent cohort of 98 BRCA mutation carriers was used for validation. Safety information was collected for all women who opted for uterine lavage in a clinic setting. We present a 7‐protein diagnostic signature, with AUC 〉 0.97 and a negative predictive value (NPV) of 100% for detecting HGOC. The AUC of the biomarker in the independent validation set was 〉 0.94 and the NPV 〉 99%. The sampling procedure was clinically acceptable, with favorable pain scores and safety. We conclude that the acquisition of Müllerian tract proximal liquid biopsies in women at high‐risk for HGOC and the application of the BRCA ‐specific diagnostic assay demonstrates high sensitivity, specificity, technical feasibility and safety. Similar classifier for an average‐risk population is warranted.

Abstract: Energy spectroscopy of strongly interacting phases requires probes which minimize screening while retaining spectral resolution and local sensitivity. Here, we demonstrate that such probes can be realized using atomic sized quantum dots bound to defects in hexagonal Boron Nitride tunnel barriers, placed at nanometric distance from graphene. With dot energies capacitively tuned by a planar graphite electrode, dot-assisted tunneling becomes highly sensitive to the graphene excitation spectrum. The spectra track the onset of degeneracy lifting with magnetic field at the ground state, and at unoccupied excited states, revealing symmetry-broken gaps which develop steeply with magnetic field - corresponding to Landé g factors as high as 160. Measured up to B  = 33 T, spectra exhibit a primary energy split between spin-polarized excited states, and a secondary spin-dependent valley-split. Our results show that defect dots probe the spectra while minimizing local screening, and are thus exceptionally sensitive to interacting states.

Abstract: Background: The outcome of elderly patients with Acute Myeloid Leukemia (AML) is poor and treatment options in these high-risk groups are limited. Recently, venetoclax combinations with hypomethylating agents or low dose cytarabine were approved to treat patients with AML ineligible for intensive chemotherapy. However limited prospective data is available on the safety and efficacy of venetoclax treatment in routine clinical practice. Israel is among the first countries to have approved venetoclax-based combinations as first line therapy for AML and this treatment is fully reimbursed via the national health system. Here we present the initial results of a prospective, multicenter, nationwide trial that sought to assess the use of venetoclax-based therapy in a real-world setting. Methods: A prospective observational nationwide multicenter trial. Newly diagnosed patients with AML were enrolled at the time of venetoclax-based therapy initiation. Demographic, clinical and patient-related baseline characteristics were documented. Treatment patterns, safety and efficacy outcomes are reported. Patient related outcomes were assessed at baseline and after cycle 3 using the EQ-5D-5L and EORTC QLQ-C30 questionnaires. Results: A total of 70 patients were enrolled between August 2019 and June 2020 (data cut off) with a median age of 75 years (range 45-88) and a median follow-up of 74 days (8-232). Two-thirds of patients were males (62.9%). Over one-quarter (28.6%) of patients had an ECOG performance status of 2 or higher; the median modified Charlson Comorbidity Index (CCI) was 0 (range 1-4) with 27.1% with a CCI ≥2. De-novo AML was documented in 44.3%, secondary AML was diagnosed in 52.8% (secondary to MDS (27.1%), MPNs (11.4%) and therapy related AML (14.3%)). European LeukemiaNet (ELN) risk category was favorable, intermediate and adverse in 8.6%, 30% and 42.9%, respectively (Table 1). Time from diagnosis to initiation of therapy was 8 days (median, range 1-38). The main reasons for choosing venetoclax-based low intensity therapy as reported by treating physicians were patient related factors (mainly age & gt;75 years, performance status) in the majority of cases and adverse disease biology predicting poor response to intensive chemotherapy in 17.1%. Of the 57 patients with available data, 38 (67%) initiated therapy in an inpatient setting with a median hospitalization duration of 12 days (range 1-62 days) and 19 (33%) patients started therapy as outpatients. By data cutoff, of 63 patients that initiated therapy 45, 23 and 7 patients completed cycle 1, cycle 3 and cycle 6 assessments, respectively. Complete remission (CR) or CR with incomplete count recovery (CRi) was achieved in 23/44 (52.3%) patients that were assessed for best response. Of responding patients, 6 (23%, 5 CRi and 1 Partial Remission (PR)) went on to receive an allogeneic transplantation (median age 70.5 years). Ninety percent of patients received venetoclax in combination with hypomethylating agents (azacytidine n=56, decitabine n=1). The full dose of 400mg was administered in 87% of cases with a median ramp-up duration of 3 days. Dose interruptions, dose modifications and dose discontinuations during follow-up were frequent and occurred in 41%, 35% and 27%, respectively. During therapy 63.5% of patients experienced adverse events (AE) of any grade; severe AE's were recorded in 41.3% of patients. Febrile neutropenia was documented in 22.2% and Tumor Lysis Syndrome (TLS) was documented in 2 patients (grade 2; 3.2%). Early death rates at 30 and 60 days were 6.3% and 11.1%, respectively. Conclusion: In the real-world setting venetoclax-based therapies are effective and associated with manageable toxicity including in the outpatient setting. In routine practice patient-related factors and disease-related factors (disease-risk) both seem to play a role in choice of therapy. Venetoclax treatment in real-life practice in Israel appears to follow general recommendations, is tolerable with approximately 90% of patients achieving target dose. These observational data are expected to provide information on patient selection patterns, efficacy and safety and patient related outcomes in patients not in clinical trial. Table Disclosures Wolach: AbbVie: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Fees for lectures and Consultancy, Research Funding; Astellas: Consultancy, Honoraria, Other: Fees for lectures and Consultancy; Pfizer: Consultancy, Honoraria; Novartis: Consultancy, Honoraria, Other: Fees for lectures and Consultancy; Amgen: Other: Fees for lectures and Consultancy; Janssen: Other: Fees for lectures and Consultancy. Levi:Abbvie Inc: Consultancy, Research Funding. Canaani:Abbvie: Consultancy, Honoraria, Research Funding. Tadmor:AbbVie: Consultancy, Speakers Bureau; Janssen: Consultancy, Speakers Bureau; Takeda: Consultancy, Speakers Bureau; Sanofi: Consultancy, Speakers Bureau; Medison: Consultancy, Speakers Bureau; Neopharm: Consultancy, Speakers Bureau; 6. Novartis Israel Ltd., a company wholly owned by Novartis Pharma AG: Consultancy, Speakers Bureau. Tavor:Abbvie: Consultancy, Honoraria, Research Funding. Hellmann:Abbvie: Research Funding. Stemer:Abbvie: Research Funding. Cohen:Abbvie Inc: Current Employment, Current equity holder in publicly-traded company. Afik:Abbvie Inc: Current equity holder in publicly-traded company. Ofek:Abbvie Inc: Current Employment. Banayan:Abbvie Inc: Current Employment, Current equity holder in publicly-traded company. Kan:Abbvie Inc: Current Employment, Current equity holder in publicly-traded company. Grunspan:Abbvie Inc: Current Employment, Current equity holder in publicly-traded company. Ofran:AbbVie: Membership on an entity's Board of Directors or advisory committees. Moshe:Astellas: Consultancy, Honoraria; Novartis: Consultancy, Honoraria; Abbvie: Consultancy, Honoraria, Research Funding.

Abstract: Introduction: Congenital TTP (Thrombotic Thrombocytopenic Purpura) is a rare life-threatening inherited disorder, resulted from mutations in ADAMTS13 gene. Such mutations interfere with ADAMTS13 enzyme production or function, subsequently resulting in microangiopathic hemolytic anemia (MAHA) and microvascular thrombosis. The investigation of congenital TTP is challenging because of its rarity with an estimated prevalence ranging from 0.4 to 16.7 cases per million and about 150 identified mutations. Recently, we identified a cohort of patients with congenital TTP from three consanguineous families of Arab Bedouin origin in southern Israel. All patients have the same, previously unidentified mutation c.3772 delA in the ADAMTS13 gene. In this single center prospective cohort study, we present patients' genetic, clinical and laboratory data and results of the abnormal ADAMTS13 protein Western blot analysis. Methods: Patients with episodes of MAHA and thrombocytopenia were diagnosed with congenital TTP by abnormally low ADAMTS13 activity and absence of inhibitory autoantibodies (Table 1). Subsequently, patients were referred for genetic testing. Patients' DNA served for PCR amplification of the exons of ADAMTS13 (NM_139026) followed by direct sequencing of the PCR products. The mutation was found in exon 28, the primers used for PCR were forward: atgtccctatgtcccacctg and reverse: ctgtccagaatcacagcacaa (annealing temperature 61°C). Western blot analysis of the abnormal ADAMTS13 protein was performed according to the method previously described by Zheng et al, using antihuman ADAMTS13 rabbit polyclonal antibody (ab28274; Abcam, Cambridge, UK). Patients' clinical and laboratory parameters were collected at diagnosis and during follow-up. The study was approved by the institutional research ethics board. Results: We identified a novel mutation on chromosome 9:136323172del A (GRCh37/hg19) in coding exon 28, c.3772 del A (NM_139026), causing p.N1258T fs Ter 15 of ADAMTS13 gene close to the C-terminus of the 1427-amino acid long protein (Fig.1). We validated that all patients in our cohort are homozygous for the mutation. The mutation is found within the CUB1 domain and the frameshift is predicted to result in the loss of the next 169 highly conserved amino acids of the full-length protein that contains the CUB2 domain, normally responsible for cleavage of large VWF multimers under flow conditions. Our Western blot analysis of the abnormal protein (Fig. 2) demonstrates that a 170-190 Kd band is missing in plasma of five patients, compared to four controls. These results suggest that the mutation may interfere with the entire enzyme production. The cohort consists of 17 homozygotic patients (3 males and 14 females), all belong to three closely related families of Arab Bedouin descent with high rate of consanguinity. All 17 patients in this cohort have blood group A. This finding may represent genetic linkage disequilibrium between the ADAMTS13 gene and the transferase gene, both found on chromosome 9 in close proximity. Despite the fact that all the patients are homozygous for the same mutation and belong to three closely related families, their presenting symptoms and disease severity were markedly heterogenous (Table 1): eight of 14 female patients initially presented with complications of pregnancy, two presented with laboratory abnormalities, two presented with stroke and two asymptomatic female patients were recognized on family screening. Of three male patients, one presented with Budd-Chiari syndrome, one had laboratory abnormalities alone and one developed a stroke. Conclusion: To the best of our knowledge, this is one of the largest congenital TTP cohorts described in the literature. This cohort is unique due to the fact that all members carry the same, previously unreported, ADAMTS13 gene mutation in the CUB1 domain of the gene. Our findings support an assumption that environmental and hereditary modifiers may influence disease course. Further research of the involved families may enable us to expand the understanding of the pathophysiology and develop better treatment options for this understudied rare condition. Disclosures No relevant conflicts of interest to declare.