GLORIA

GEOMAR Library Ocean Research Information Access

X

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 11
    Online Resource
    Online Resource
    Thrombotic Complications Are Associated with Phlebotomy Therapy in Patients with Chuvash Polycythemia
    American Society of Hematology ; 2015
    In:  Blood Vol. 126, No. 23 ( 2015-12-03), p. 936-936
    Details
    In: Blood, American Society of Hematology, Vol. 126, No. 23 ( 2015-12-03), p. 936-936
    Abstract: Background: In Chuvash polycythemia (CP) (Problemi Gematologii I Perelivaniya Krovi 1974, 10:30), impaired degradation of hypoxia inducible factor (HIF)-1α and HIF-2α from a homozygous germline VHLR200W mutation leads to augmented hypoxic responses during normoxia (Nat Genet 2002, 32:614). In addition to elevated hematocrit, CP is marked by leg varices, benign vertebral hemangiomas, decreased systemic blood pressure, increased systolic pulmonary artery pressure, and by the defining phenotypes of thrombosis and early mortality (Blood 2004, 103:3924; Haematologica 2012, 97:193). There is no effective therapy. While phlebotomy has been recommended for idiopathic polycythemia by the British Committee for Standards in Haematology (Br J Haematol 2005, 130:174) and is administered to some CP patients, its benefits are unknown. Phlebotomy-induced iron deficiency inhibits PHD2 enzyme, the principal negative regulator of HIFs, which further augments hypoxic responses. This affects the transcription of many genes (BCMD 2014, 52:35). Hypoxia-regulated IRAK1 is augmented in inflammation and may promote thrombosis (Circ Res. 2013, 112:103). Methods: 165 patients with CP were enrolled in a registry between 2001 and 2009 after providing written informed consent. Survival analysis was used to examine the predictors of new thrombosis and death during the follow-up period. mRNA from peripheral blood mononuclear cells (PBMCs) was profiled by Affymetrix Human Exon 1.0 ST Array in 42 of the subjects. Results: The median age at enrollment was 35 years and 90 participants were females, 25 had a history of one thrombosis, 5 of two thromboses and 3 of three thromboses. In the year prior to study entry, 72 had received phlebotomy therapy (Table 1). In July 2015 the median follow-up was 9.0 years (range 1-14.5). During this follow-up period, 30 (18.2%) participants had one new thrombosis, 6 (3.6%) had two new thromboses and 17 (10.3%) died. The median age of death was 55 years (range 16-76) and deaths were related to thrombotic cerebrovascular accident (n = 4), myocardial infarction (n = 4), mesenteric or portal vein thrombosis (n = 3), other major thromboembolic events (n = 2) and trauma or unknown cause (n = 2). Baseline characteristics of older age, prior thrombosis, pentoxifylline treatment, smoking and splenomegaly were independently associated with greater thrombosis risk during follow-up (P 〈 0.003). After adjustment for these variables, the estimated probability of new thrombosis at 10 years was 26% in those receiving phlebotomies compared to 12% in those not phlebotomized (log rank P = 0.014) (Figure 1). There was also a trend for increased risk of death with phlebotomy: estimated probability 8.7% versus 3.7% (P = 0.15). Examination of gene transcripts affecting thrombosis by logistic regression identified 12 protective and 16 risk genes at 5% false discovery rate. Upregulation of two mRNAs was of singular significance: 1) IL1RAP, a proximal signaling adaptor of IRAK1 (Immunity 1997, 7: 837) and 2) THBS1, encoding thrombospondin1 (Blood 2015, 125: 399). Both genes have known roles in thrombosis promotion and we previously reported that THBS1 is upregulated in CP (BCMD 2014, 52:35). Further analysis revealed a further upregulation of THBS1 in patients with baseline history of phlebotomy (β=0.41, P=0.046). Conclusion: These findings underscore a high rate of thrombosis and death in patients with CP and reveal a potential role of increased IRAK1/IL1RAP signaling in these complications. They raise the possibility that phlebotomy therapy has a detrimental rather than beneficial effect, possibly contributed to by increased THBS1 expression. Table 1. Baseline characteristics by phlebotomy in the year prior to enrollment. Results in median (interquartile range) or n (%); four without phlebotomy data. No phlebotomy N=89 Received phlebotomy N=72 Age (years) 32 (18-48) 37 (26-49) 0.08 Female gender, n (%) 52 (58%) 34 (47%) 0.16 Smoking, n (%) 18 (20%) 24 (33%) 0.060 History of thrombosis, n (%) 20 (23%) 12 (17%) 0.4 Splenomegaly, n (%) 2 (2.3%) 2 (2.8%) 0.8 ASA treatment, n (%) 27 (30%) 36 (50%) 0.011 Pentoxifylline, n (%) 7 (7.9%) 17 (23.6%) 0.005 BMI (kg/m2) 20.4 (18.3-22.9) 21.6 (19.9-24.6) 0.010 Systolic BP (mm Hg) 109 (100-123) 118 (105-124) 0.6 Diastolic BP (mm Hg) 76 (68-84) 78 (71-83) 0.8 Hemoglobin (g/dL) 18.1 (16.4-21.0) 17.9 (16.0-19.8) 0.5 WBC (per uL) 5.7 (4.6-7.0) 5.5 (4.6-6.7) 0.9 Figure 1. Figure 1. Disclosures No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    URL: Article
    DOI: 10.1182/blood.V126.23.936.936
    RVK:
    XA 33000
    RVK:
    XA 10000
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2015
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 12
    Online Resource
    Online Resource
    Hydroxyurea Treatment Is Associated with Elevated Serum Erythropoietin Concentration but Suppressed Global Hypoxic Transcriptional Responses in Sickle Cell Disease
    American Society of Hematology ; 2015
    In:  Blood Vol. 126, No. 23 ( 2015-12-03), p. 3380-3380
    Details
    In: Blood, American Society of Hematology, Vol. 126, No. 23 ( 2015-12-03), p. 3380-3380
    Abstract: Background The level of distorted erythrocytes due to polymerization of hemoglobin S in sickle cell disease (SCD) (Science 1949;110:543) is a major determinant of the severity of hemolysis and microvascular occlusion (Lancet 2010;376:2018). Erythropoietin (EPO) is elevated in SCD due to hemolytic anemia and a related increase in hypoxia-inducible factors (HIFs) (Eur J Haematol 2007;78:183). Hydroxyurea (HU) is widely used in the treatment of SCD. HU inhibits ribonucleotide reductase (Semin Oncol 1992;19(3 Suppl 9):1-10) and promotes γ globin synthesis thereby increasing HbF-containing erythrocytes (F cells) while suppressing sickle β hemoglobin production (J Clin Invest 1984;74:652 and 2003;111:231). Increased level of F cells reduces hemolysis and ameliorates clinical complications in SCD. We and others have observed an increase in serum EPO level with HU treatment in SCD despite an increase in the hemoglobin concentration, and we hypothesized that this may be due to the known increased affinity of hemoglobin F for oxygen and related tissue hypoxia (Blood 2009;114:4639). Methods Messenger RNA from peripheral blood mononuclear cells (PBMCs) was profiled using Affymetrix Human Exon 1.0 ST Array. Hypoxic transcriptional alteration was defined in 15 Chuvash polycythemia (CP) patients vs. 17 control individuals. CP leads to constitutive up-regulation of HIFs in the absence of anemia or hypoxia. Transcriptional alteration in SCD was determined in 13 HbSS subjects without HU treatment vs. 16 control individuals, and that induced by HU treatment was determined in 19 HbSS subjects with vs. 13 without HU treatment. For meta-analysis on serum EPO concentration, genomic DNA isolated from PBMCs was hybridized to the Illumina Human 610-Quad SNP array. Genotypes were imputed to 1000 genomes project phase 1 data. A linear regression model was applied adjusting for age, gender, hemoglobin concentration, and HU treatment. Results Gene expression changes by HbSS highly correlated with those associated with homozygous VHLR200W (Pearson's r=0.79, Figure 1A). At 5% false discovery rate (FDR), expression levels of 377 genes were altered in both VHLR200W homozygotes and HbSS by 〉 1.2 fold. For these hypoxic genes, the correlation of expression changes between HbSS and homozygous VHLR200W reached r=0.97 (Figure 1B). In contrast to our hypothesis, HU treatment in general suppressed expression changes induced by HbSS (r=-0.85, Figure 1C), especially for the hypoxic genes (r=-0.95, Figure 1D). In VHLR200W homozygotes, 62 of the hypoxic genes correlated with plasma EPO levels (adjusted P 〈 0.05, n=42). These EPO-correlated genes were the most strongly up-regulated hypoxic genes in HbSS (red points in Figure 1B) and also the most strongly suppressed by HU treatment (red points in Figure 1D). Consistent with previous observations, we found that EPO was elevated by HU treatment in two SCD cohorts, and this persisted after adjusting for covariates including hemoglobin concentration which reflects hypoxic as well as inflammatory and hemolytic responses: Walk-PHaSST (β=0.49, P=2.5×10-15, n=586) and PUSH children (β=0.34, P=2.5×10-7, n=387). This observation suggests that biological signals independent of hypoxic regulation may contribute to EPO production under HU treatment. In a meta-analysis for the Walk-PHaSST and PUSH children cohorts, SNP rs60684937, located within the first intron of MAP2K6, an upstream regulator of HIF signaling (Mole Cell Biol 2005; 25:4853), was significantly associated with EPO levels at genome-wide significance (combined P=3.5×10-8). The C allele of the SNP decreased EPO levels in both Walk-PHaSST (β=-0.30, n=388) and PUSH children (β=-0.24, n=249) cohorts. This association was validated in an additional 89 SCD patients from the Howard cohort (β=-0.39, P=0.011). Further investigations are needed to determine whether the causal polymorphism affects protein function or gene regulation of the nearby genes. Discussion Our study demonstrates a prominent release from hypoxic transcriptional responses by HU treatment in SCD despite an increase in serum EPO, a defining characteristic of an up-regulated hypoxic response. Our study hypothesizes that hypoxia-independent signals trigger EPO production in the setting of HU therapy and it identifies a potential genetic determinant in this alternative pathway. Figure 1. Figure 1. Disclosures No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    URL: Article
    DOI: 10.1182/blood.V126.23.3380.3380
    RVK:
    XA 33000
    RVK:
    XA 10000
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2015
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 13
    Online Resource
    Online Resource
    Type I Methemoglobinemia Caused by the Cytochrome b5 Reductase 806C〉T Mutation Is Present in the Indigenous Evenk People of Yakutia.
    American Society of Hematology ; 2009
    In:  Blood Vol. 114, No. 22 ( 2009-11-20), p. 2588-2588
    Details
    In: Blood, American Society of Hematology, Vol. 114, No. 22 ( 2009-11-20), p. 2588-2588
    Abstract: Abstract 2588 Poster Board II-564 Background: Congenital methemoglobinemia is an autosomal recessive metabolic disorder due to NADH-cytochrome b5 reductase (cytb5r, EC 1.6.2.2) deficiency. This enzyme exists in soluble and membrane-bound forms. The soluble erythrocytic cytb5r isoenzyme is involved in cytochrome b5 reduction and in erythrocyte methemoglobin reduction; the membrane-bound microsomal enzyme participates in a fatty acid desaturation complex and in drug metabolism. The cytb5r isoforms are a product of a single gene locus, DIA1 (or CYB5R3), on chromosome 22. Type I methemoglobinemia, a benign form in which cyanosis is the only phenotype, is characterized by cytb5r deficiency restricted to red blood cells. In less common type II methemoglobinemia, chronic cyanosis is associated with severe neurological and developmental deficits, including mental retardation, microcephaly, generalized dystonia and movement disorders. More then 40 mutations have been reported to date in the DIA1 gene, which either cause type I or type II methemoglobinemia; the majority are missense mutations and are associated with type I disease. Both methemoglobinemia types are sporadic worldwide but are claimed to be endemic among the Yakut people in Siberia, the Aleutians in Alaska and the Navajo tribe in the continental US. In 2006, a new mutation in exon 9 of the CYB5R3 gene (806C 〉 T, Pro269Leu) was identified in 38 patients from the indigenous population of Yakutia in northeastern Siberia, a part of the Russian Federation (1). The frequency of homozygotes was reported to be 1 in 5677. The Sakha region of the Yakutia Republic has an area of 1,200,000 sq miles and a population 〈 1 million composed of 45.5% Yakuts, 41.2% Russians, 3.7% Ukrainians and indigenous people including 1.9% Evenks, 1.2% Evens, 0.1% Dolgans, and 0.1% Yukagirs. Methods: We screened DNA of 162 subjects' samples taken from children of indigenous people from 4 different places in Sakha for the mutation 806C 〉 T in the CYB5R3 gene using the the AluI and AciI restriction enzymes that recognize this mutation, and the results were confirmed by sequencing of the PCR product. Results: The study sample included 70 Evenks, 35 Evens, 26 Sakha (Yakuts), 23 Yukagirs, 4 Chukchas, 2 Dolgans, 1 Nenets and 1 Tatar. We found 2 806C 〉 T heterozygous samples detected by the AciI restriction enzyme and confirmed by sequencing; both subjects were Evenks. The enzyme AluI produced a partial cut in another 22 samples that could not by confirmed as a true mutation by sequencing. Thus, the analysis with the AluI restriction enzyme frequently falsely identified heterozygotes among these 162 participants. Conclusion: In screening for the CYB5R3 806C 〉 T mutation, the AciI restriction enzyme should be used instead of the AluI enzyme. Based on these results and according to Hardy-Weinberg equilibrium, the predicted frequency of homozygotes for the CYB5R3 806C 〉 T gene mutation is 1 in 4,444 among the Evenks. These data suggest that the CYB5R3 806C 〉 T mutation may be endemic among the Evenks indigenous people. Further, it remains to be determined whether the CYB5R3 806C 〉 T mutation is also causative of type I methemoglobinemia in the Aleutian and Navajo peoples whose ancestors migrated to North America from Siberia. These data are preliminary and larger population-based studies using the AciI restriction enzyme are planned. Acknowledgments: This work was supported by the ASH Visitor Training Program Award and by NHLBI Grant 2 UH1-HL03679. References 1) Гaлeeвa H.M., Haзapeнкo Л.П., Haзapeнкo C.A., Tвepcкaя C.M., Пoлякoв A.B. Moлeкyляpнo-гeнeтичecкaя пpичинa нacлeдcтвeн|Ryoй мeтгeмoглoбинeми|Rb лepвoгo типa в Якyти|Rb. Meдицинcкaя Гeнeтикa (2006). Disclosures: No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    URL: Article
    DOI: 10.1182/blood.V114.22.2588.2588
    RVK:
    XA 33000
    RVK:
    XA 10000
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2009
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 14
    Online Resource
    Online Resource
    Ferroportin Q248H Mutation Prevents Its Ubiquitination
    American Society of Hematology ; 2013
    In:  Blood Vol. 122, No. 21 ( 2013-11-15), p. 2196-2196
    Details
    In: Blood, American Society of Hematology, Vol. 122, No. 21 ( 2013-11-15), p. 2196-2196
    Abstract: Ferroportin Q248H mutation is prevalent in African populations and leads to increased serum ferritin. Our recent study shows that ferroportin Q248H protein is resistant to physiologic hepcidin concentrations1. Also sickle cell disease patients with ferroportin Q248H heterozygote had lower serum ferritin concentration suggesting that the enhanced iron release by macrophages. Ferroportin glutamine 248 is located within the intracellular loop (residues 228-307), which is likely to be located in the cytoplasm. Recently ferroportin internalization was shown to be driven by ubiquitination of lysines lying within residues 229-269 including K229, K240, and K2472. The proximity of the K240 and especially to K247 to the Q248 residue suggests that a positively charged histidine in position 248 might change the overall negative charge of the 240eeetelkqlnlhk253sequence toward a more positive charge, which might affect ubiquitination and subsequent degradation of ferroportin. Here we analyzed and compared ubiquitination of WT and Q248H mutant ferroportin. Results WT ferroportin and Q248H mutant were expressed as EGFP-fusions in 293T cells and also combined with the expression of ubiquitin. Ferroportin was immunoprecipitated with anti-EGFP antibodies and analyzed by high resolution mass spectrometry using LTQ-Orbitrap. Phosphorylation and ubiquitination was determined using Proteome Discover and quantified using SIEVE 2.1 software. Conclusions WT ferroportin but not the Q248H mutant ferroportin was found to be ubquitinated on lysines 247 and 253 and also phosphorylated on Thr 144. Also WT ferroportin was found to associate with ubiquitine-conjugating enzyme E2 and ubiquitine protein ligase NEDD4. Thus hepcidin resistance of ferroportin Q248H could be due to its inability to undergo ubiquitination. Acknowledgments This project was supported by NIH Research Grants 8G12MD007597 and P30HL107253. References 1. Nekhai S, Xu M, Foster A, et al. Reduced sensitivity of the ferroportin Q248H mutant to physiological concentrations of hepcidin. Haematologica. 2013;98(3):455-463. 2. Qiao B, Sugianto P, Fung E, et al. Hepcidin-induced endocytosis of ferroportin is dependent on ferroportin ubiquitination. Cell Metab. 2012;15(6):918-924. Disclosures: No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    URL: Article
    DOI: 10.1182/blood.V122.21.2196.2196
    RVK:
    XA 33000
    RVK:
    XA 10000
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2013
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 15
    Online Resource
    Online Resource
    Effect of Phlebotomy Therapy On Hemoglobin Concentration and Tricuspid Regurgitation Velocity in Chuvash Polycythemia.
    American Society of Hematology ; 2009
    In:  Blood Vol. 114, No. 22 ( 2009-11-20), p. 1897-1897
    Details
    In: Blood, American Society of Hematology, Vol. 114, No. 22 ( 2009-11-20), p. 1897-1897
    Abstract: Abstract 1897 Poster Board I-920 Background: Chuvash polycythemia is caused by homozygosity for the VHL598C 〉 T mutation, which leads to up-regulation of HIF-1a and HIF-2a in normoxia. As the result, circulating concentrations of erythropoietin are elevated. Chuvash polycythemia patients suffer from cardiovascular abnormalities that include pulmonary arterial hypertension, thrombosis and stroke. Phlebotomy is a common therapy for patients to decrease symptoms such as plethora and headache. However, the outcomes of phlebotomy have not been assessed for these patients. The objective of this analysis is to evaluate the effect of phlebotomy on hemoglobin concentration, serum concentrations of ferritin and erythropoietin, and echocardiographically-determined tricuspid regurgitation velocity, which reflects systolic pulmonary artery pressure. Methods: One hundred twenty patients homozygous for VHL598C 〉 T and 38 controls of comparable age and gender from Chuvash Republic of the Russian Federation were studied. Clinical and demographic characteristics were determined and echocardiography was performed. Serum ferritin and erythropoietin concentrations were measured by ELISA. Results: The median (interquartile) age for Chuvash polycythemia cases was 36 (22–48) years. They included 68 females (56%). Chuvash polycythemia patients had higher serum erythropoietin concentration (medians of 46 versus 8 mIU/ml, P = 0.0001) and lower serum ferritin concentration (medians of 12 versus 48 ng/ml, P = 0.0001) compared to controls. Tricuspid regurgitation velocity was higher in cases than controls (medians of 2.5 vs. 2.3 m/sec, P = 0.007). Among the cases, 87 (71%) had a history of phlebotomy and 54 of these had phlebotomy within the last year. Phlebotomy was associated with higher erythropoietin concentration (P = 0.033) and lower ferritin concentration (P = 0.024) but no significant difference in hemoglobin concentration (P = 0.9) (Table 1). After adjusting for the effect of age, phlebotomy was associated with significantly higher odds of tricuspid regurgitation velocity ≥2.5 (m/sec) (odds ratio: 3.3; 95% CI: 1.1–9.9). Conclusion: Patients with Chuvash polycythemia tend to mobilize iron stores and increase erythropoietin production to maintain a constant, elevated hemoglobin concentration despite phlebotomy therapy. In this process, estimated pulmonary systolic blood pressure appears to increase. Therefore, phlebotomy therapy might be a risk factor for pulmonary hypertension in the context of Chuvash polycythemia. Disclosures: No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    URL: Article
    DOI: 10.1182/blood.V114.22.1897.1897
    RVK:
    XA 33000
    RVK:
    XA 10000
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2009
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 16
    Online Resource
    Online Resource
    Mass-Spectrometry Analysis of Urinary Biomarkers of Endothelial Injury in Sickle Cell Anemia Patients
    American Society of Hematology ; 2020
    In:  Blood Vol. 136, No. Supplement 1 ( 2020-11-5), p. 28-29
    Details
    In: Blood, American Society of Hematology, Vol. 136, No. Supplement 1 ( 2020-11-5), p. 28-29
    Abstract: BACKGROUND : Sickle cell anemia (SCA) patients are predisposed to the development of chronic kidney disease (CKD). Vascular dysfunction plays an important role in the etiology of CKD and is a major complication in SCA. Biomarkers of endothelial dysfunction VCAM and Activin A were recently described for diagnostics of CKD in Diabetic Kidney Disease and Systemic Lupus Erythematosus. Previously, we identified several urinary biomarkers of CKD in SCA patients using mass-spectrometry analysis. These biomarkers reflect the pathophysiology of SCA, including markers of iron homeostasis (ceruloplasmin (CP), transferrin (TrF), hemoglobin (Hgb), ferritin (FrT)); inflammation (orosomucoid (ORM)); and glomerular hyperfiltration (HGFL). However, the urinary biomarkers of endothelial injury in SCA patients are unknown. HYPOTHESIS: We hypothesized that urinary biomarkers of endothelial injury can be identified by mass-spectrometry and that they correlate with hemoglobinuria and hyperfiltration. METHODS: We tested mass-spectrometry data obtained from spot urine samples of 19 SCA patients without CKD in a steady state from the University of Illinois at Chicago. Samples were run in triplicates (total 57 spectra) and mass spectrometry analysis was carried out using Proteome Discoverer 2.2 (Thermo Fisher Scientific) and Ingenuity Pathway Analysis (IPA, Qiagen) software. Protein abundances were calculated using Proteome Discoverer 2.2 and correlated with hyperfiltration and hemoglobinuria. RESULTS: We re-analyzed previously obtained mass-spectra using the recently released Proteome Discoverer 2.2 program and identified 819 proteins that were further analyzed with IPA software. Proteins were sorted into the categories associated with renal necrosis (31 proteins), glomerular injury (16 proteins), and renal hypoplasia (9 proteins) using IPA. Because of a lack of vascular injury pathways in IPA, nine proteins associated with endothelial or vascular injury were manually picked including VCAM and Activin A (Table 1). Abundances were calculated for each of the nine selected proteins related to endothelial injury in 57 samples and normalized to the urinary creatinine. Results were stratified for hemoglobinuria and hyperfiltration. Four proteins showed 2-4 fold higher abundances in the samples with hemoglobinuria (BMPER, NRG3, MKI67, and TJP2), but the increase was statistically significant for NRG3 and MKI67 only. In the samples from patients with hyperfiltration, BAMBI and NOS2 abundances were increased over 2-fold but the abundance of NRG3 was decreased. Ingenuity network analysis showed changes in immunoglobulin production for MKI67 network; ERK1/2 signaling for NRG3 pathway; cell cycle and NF-kB signaling for BAMBI and cell cycle proteins and RNA polymerase II transcription for NOS2 network. CONCLUSIONS: Markers of endothelial injury are found in the urinary proteome in correlation with hemoglobinuria and hyperfiltration. Further analysis to validate these biomarkers and correlate them with CKD progression is needed. LIMITATION: Research participants were from a small cohort of patients from one center. ACKNOWLEDGMENTS: This work was supported by NIH Research Grants (1P50HL118006, 1R01HL125005, 5G12MD007597 and 1SC1HL150685). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Disclosures Saraf: Novartis, Global Blood Therapeutics: Membership on an entity's Board of Directors or advisory committees; Global Blood Therapeutics: Membership on an entity's Board of Directors or advisory committees, Other: Advisory Boards, Speakers Bureau; Pfizer, Global Blood Therapeutics, Novartis: Research Funding. Gordeuk:Imara: Research Funding; Ironwood: Research Funding; Novartis: Consultancy; CSL Behring: Consultancy, Research Funding; Global Blood Therapeutics: Consultancy, Research Funding.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    URL: Article
    DOI: 10.1182/blood-2020-138446
    RVK:
    XA 33000
    RVK:
    XA 10000
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2020
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 17
    Online Resource
    Online Resource
    The Hypoxic Response and Altered Gene Expression in Patients with Sickle Cell Disease
    American Society of Hematology ; 2012
    In:  Blood Vol. 120, No. 21 ( 2012-11-16), p. 3245-3245
    Details
    In: Blood, American Society of Hematology, Vol. 120, No. 21 ( 2012-11-16), p. 3245-3245
    Abstract: Abstract 3245 Sickle cell disease (SCD) and Chuvash polycythemia (CP) are both monogenic hematologic disorders, the first resulting in hemolytic anemia and the second in polycythemia related to an upregulated hypoxic response at normoxia. Specifically, homozygosity for the VHLR200W mutation leads to increased levels of the transcription factors hypoxia inducible factor (HIF)-1 and HIF-2 at normoxia and altered transcription of many genes. Much attention in the pathophysiology of SCD has focused on the adverse effects of chronic inflammation, enhanced cellular adhesion pathways and hemolytic rate. However, the chronic anemia of SCD is associated with an upregulation of the hypoxic response as evidenced by high erythropoietin concentrations. In this prospective study, we compared gene expression alterations in peripheral blood mononuclear cells in SCD and CP. Our pre-specified hypothesis was that we could identify hypoxia-mediated gene expression alterations in SCD through a comparison with altered gene expression in CP and reveal molecular pathways that are potentially shared by these two conditions. We prospectively compared gene expression profiles in two independent cohorts, an SCD cohort comprised of 22 SCD patients and 19 African American controls and a CP cohort comprised of 8 VHLR200W homozygotes and 17 Chuvash controls with wildtype VHL. Because iron deficiency can influence the hypoxic response, we excluded iron-deficient subjects from each cohort. We used the identical Affymetrix exon array platform for both cohorts. Differential gene expression was highly correlated between the two conditions, with Spearman correlation ρ = 0.75 between their expression profiles across 16,642 genes, suggesting that 56% of expression variation triggered by beta hemoglobin mutation in SCD may be explained by hypoxic transcriptional responses. A small portion of differential genes were highly induced in both conditions. Among 54 genes up-regulated 〉 1.5-fold in SCD patients, 24 (44%) overlapped with the 31 genes up-regulated 〉 1.5-fold in VHLR200W homozygotes. The genes highly induced in both conditions included FAM46C (family with sequence similarity 46 member C), SELENBP1 (selenium binding protein 1), IL1B (interleukin 1, beta), MOP-1, SNCA (synuclein, alpha), GMPR (guanosine monophosphate reductase), BPGM (2,3-bisphosphoglycerate mutase), SLC25A37 (solute carrier family 25 member 37), CA1 (carbonic anhydrase I), DCAF12 (DDB1 and CUL4 associated factor 12), EPB42 (erythrocyte membrane protein band 4.2), AHSP (alpha hemoglobin stabilizing protein), SLC4A1 (solute carrier family 4 member 1), HBB (hemoglobin, beta), HBD (hemoglobin, delta), CSDA (cold shock domain protein A), FECH (ferrochelatase), BCL2L1 (BCL2-like 1), OSBP2 (oxysterol binding protein 2), APOBEC3A (apolipoprotein B mRNA editing enzyme catalytic polypeptide-like 3A), IFIT1 (interferon-induced protein with tetratricopeptide repeats 1), IFIT3 (interferon-induced protein with tetratricopeptide repeats 3), IFI44L (interferon-induced protein 44-like), and IFI27 (interferon, alpha-inducible protein 27). Three genes were down-regulated 〉 1.5-fold in SCD patients. One of these, GIMAP7 (GTPase, IMAP family member 7), was among the 11 genes down-regulated 〉 1.5-fold in VHLR200Whomozygotes. These results suggest that there is a broad upregulation of the hypoxic response in SCD and that the hypoxic response may underlie or interact with an important proportion of the clinical and pathophysiologic manifestations of SCD. Disclosures: No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    URL: Article
    DOI: 10.1182/blood.V120.21.3245.3245
    RVK:
    XA 33000
    RVK:
    XA 10000
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2012
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 18
    Online Resource
    Online Resource
    Ebola virus-mediated T-lymphocyte depletion is the result of an abortive infection
    Public Library of Science (PLoS) ; 2019
    In:  PLOS Pathogens Vol. 15, No. 10 ( 2019-10-24), p. e1008068-
    Details
    In: PLOS Pathogens, Public Library of Science (PLoS), Vol. 15, No. 10 ( 2019-10-24), p. e1008068-
    Type of Medium: Online Resource
    ISSN: 1553-7374
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    URL: Article
    DOI: 10.1371/journal.ppat.1008068
    DOI: 10.1371/journal.ppat.1008068.g001
    DOI: 10.1371/journal.ppat.1008068.g002
    DOI: 10.1371/journal.ppat.1008068.g003
    DOI: 10.1371/journal.ppat.1008068.g004
    DOI: 10.1371/journal.ppat.1008068.g005
    DOI: 10.1371/journal.ppat.1008068.g006
    DOI: 10.1371/journal.ppat.1008068.s001
    DOI: 10.1371/journal.ppat.1008068.s002
    DOI: 10.1371/journal.ppat.1008068.s003
    DOI: 10.1371/journal.ppat.1008068.s004
    DOI: 10.1371/journal.ppat.1008068.s005
    DOI: 10.1371/journal.ppat.1008068.s006
    DOI: 10.1371/journal.ppat.1008068.s007
    Language: English
    Publisher: Public Library of Science (PLoS)
    Publication Date: 2019
    detail.hit.zdb_id: 2205412-1
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 19
    Online Resource
    Online Resource
    A130: Is the CCR5‐delta32 Mutation Protective Against Systemic‐Onset Juvenile Idiopathic Arthritis?
    Wiley ; 2014
    In:  Arthritis & Rheumatology Vol. 66, No. S3 ( 2014-03)
    Details
    In: Arthritis & Rheumatology, Wiley, Vol. 66, No. S3 ( 2014-03)
    Abstract: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5‐ delta32—a 32 base pair deletion in the coding region—in various ethnic groups is associated with the severity and prevalence of chemokine‐mediated autoimmune diseases, systemic‐onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5‐delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5‐delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role. Methods: 234 children (193 of European origin, 25–Hispanic or Latino, 14–Afro‐Americans, 3–of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5‐ Δ32‐F: 5′CTTCATTACACCTGCAGTC3′, CCR5‐Δ32‐R: 5′TGAAGATAAGCCTCACAGCC3′ by following condition: 95°–5′×1; 95°–15″→55°–15″→72°–60″×40; 72°–10′×3→4°–∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus. Results: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5‐delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10–18% for Northwestern Russia, Kofiady, 2008; 11,8%– for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5‐delta32 genotype was associated with milder so‐JIA course and predominance of the articular features over systemic. Sign CCR5‐delta32 (+)Mediana (frst quartile; thrd quartile) CCR5‐delta32 (–) Mediana (frst quartile; thrd quartile) p AST, U/l 30.5 (25.1; 36.5) 50.6 (36.1; 69.0) 0.003 LDH, U/l 386.0 (382.0; 543.0) 1049.0 (635.0; 1086.0) 0.02 Total protein, g/l 76.5 (73.1; 82.5) 67.0 (65.0; 70.0) 0.01 Ferritin, µg/l 1200.0 (1200.0; 1200.0) 1278.0 (117.0; 2629.0) 0.0000001 Polyarticular course, (%) 100.0 20.0 0.015 Conclusion: The results of the study may be considered rather not supporting the idea of the protective role of the CCR5‐delta32 mutation against soJIA, though the revealed associations—most of them related to the signs of the Macrophage Associated Syndrome—can be the basis for a more sophisticated research.
    Type of Medium: Online Resource
    ISSN: 2326-5191 , 2326-5205
    URL: Issue
    URL: Article
    DOI: 10.1002/art.v66.S3
    DOI: 10.1002/art.38551
    RVK:
    XA 10000
    RVK:
    XA 30325
    Language: English
    Publisher: Wiley
    Publication Date: 2014
    detail.hit.zdb_id: 2754614-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 20
    Online Resource
    Online Resource
    CDK13, a New Potential Human Immunodeficiency Virus Type 1 Inhibitory Factor Regulating Viral mRNA Splicing
    American Society for Microbiology ; 2008
    In:  Journal of Virology Vol. 82, No. 14 ( 2008-07-15), p. 7155-7166
    Details
    In: Journal of Virology, American Society for Microbiology, Vol. 82, No. 14 ( 2008-07-15), p. 7155-7166
    Abstract: The human immunodeficiency virus type 1 (HIV-1) Tat is a 14-kDa viral protein that acts as a potent transactivator by binding to the transactivation-responsive region, a structured RNA element located at the 5′ end of all HIV-1 transcripts. Tat transactivates viral gene expression by inducing the phosphorylation of the C-terminal domain of RNA polymerase II through several Tat-activated kinases and by recruiting chromatin-remodeling complexes and histone-modifying enzymes to the HIV-1 long terminal repeat. Histone acetyltransferases, including p300 and hGCN5, not only acetylate histones but also acetylate Tat at lysine positions 50 and 51 in the arginine-rich motif. Acetylated Tat at positions 50 and 51 interacts with a specialized protein module, the bromodomain, and recruits novel factors having this particular domain, such as P/CAF and SWI/SNF. In addition to having its effect on transcription, Tat has been shown to be involved in splicing. In this study, we demonstrate that Tat interacts with cyclin-dependent kinase 13 (CDK13) both in vivo and in vitro. We also found that CDK13 increases HIV-1 mRNA splicing and favors the production of the doubly spliced protein Nef. In addition, we demonstrate that CDK13 acts as a possible restriction factor, in that its overexpression decreases the production of the viral proteins Gag and Env and subsequently suppresses virus production. Using small interfering RNA against CDK13, we show that silencing of CDK13 leads to a significant increase in virus production. Finally, we demonstrate that CDK13 mediates its effect on splicing through the phosphorylation of ASF/SF2.
    Type of Medium: Online Resource
    ISSN: 0022-538X , 1098-5514
    URL: Article
    DOI: 10.1128/JVI.02543-07
    Language: English
    Publisher: American Society for Microbiology
    Publication Date: 2008
    detail.hit.zdb_id: 1495529-5
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...