GLORIA

GEOMAR Library Ocean Research Information Access

X

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • MDPI AG  (369)
Material
Publisher
  • MDPI AG  (369)
Person/Organisation
Language
Years
FID
  • 1
    Online Resource
    Online Resource
    Voxel-Mirrored Homotopic Connectivity Is Altered in Meibomian Gland Dysfunction Patients That Are Morbidly Obese
    MDPI AG ; 2022
    In:  Brain Sciences Vol. 12, No. 8 ( 2022-08-15), p. 1078-
    Details
    In: Brain Sciences, MDPI AG, Vol. 12, No. 8 ( 2022-08-15), p. 1078-
    Abstract: Purpose: To investigate the altered functional connectivity (FC) of the cerebral hemispheres in patients with morbid obesity (MO) with meibomian gland dysfunction (MGD) by voxel-mirrored homotopic connectivity (VMHC). Methods: Patients and matched healthy controls (HCs) were recruited, and all subjects underwent functional resonance magnetic imaging (fMRI), and VMHC results were processed statistically to assess the differences in FC in different brain regions between the two groups. We further used ROC curves to evaluate the diagnostic value of these differences. We also used Pearson’s correlation analysis to explore the relationship between changes in VMHC values in specific brain regions, visual acuity, and Mini-Mental State Examination (MMSE) score. Conclusions: Patients with morbid obesity and MGD had abnormal FC in the cerebral hemispheres in several specific brain areas, which were mainly concentrated in pathways related to vision and perception and may correlate to some extent with the clinical presentations of the patients.
    Type of Medium: Online Resource
    ISSN: 2076-3425
    URL: Article
    DOI: 10.3390/brainsci12081078
    Language: English
    Publisher: MDPI AG
    Publication Date: 2022
    detail.hit.zdb_id: 2651993-8
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 2
    Online Resource
    Online Resource
    MiR-25 Protects Cardiomyocytes against Oxidative Damage by Targeting the Mitochondrial Calcium Uniporter
    MDPI AG ; 2015
    In:  International Journal of Molecular Sciences Vol. 16, No. 3 ( 2015-03-10), p. 5420-5433
    Details
    In: International Journal of Molecular Sciences, MDPI AG, Vol. 16, No. 3 ( 2015-03-10), p. 5420-5433
    Abstract: MicroRNAs (miRNAs) are a class of small non-coding RNAs, whose expression levels vary in different cell types and tissues. Emerging evidence indicates that tissue-specific and -enriched miRNAs are closely associated with cellular development and stress responses in their tissues. MiR-25 has been documented to be abundant in cardiomyocytes, but its function in the heart remains unknown. Here, we report that miR-25 can protect cardiomyocytes against oxidative damage by down-regulating mitochondrial calcium uniporter (MCU). MiR-25 was markedly elevated in response to oxidative stimulation in cardiomyocytes. Further overexpression of miR-25 protected cardiomyocytes against oxidative damage by inactivating the mitochondrial apoptosis pathway. MCU was identified as a potential target of miR-25 by bioinformatical analysis. MCU mRNA level was reversely correlated with miR-25 under the exposure of H2O2, and MCU protein level was largely decreased by miR-25 overexpression. The luciferase reporter assay confirmed that miR-25 bound directly to the 3' untranslated region (UTR) of MCU mRNA. MiR-25 significantly decreased H2O2-induced elevation of mitochondrial Ca2+ concentration, which is likely to be the result of decreased activity of MCU. We conclude that miR-25 targets MCU to protect cardiomyocytes against oxidative damages. This finding provides novel insights into the involvement of miRNAs in oxidative stress in cardiomyocytes.
    Type of Medium: Online Resource
    ISSN: 1422-0067
    URL: Article
    DOI: 10.3390/ijms16035420
    Language: English
    Publisher: MDPI AG
    Publication Date: 2015
    detail.hit.zdb_id: 2019364-6
    SSG: 12
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 3
    Online Resource
    Online Resource
    Four New Species of Russula Subsection Sardoninae from China
    MDPI AG ; 2023
    In:  Journal of Fungi Vol. 9, No. 2 ( 2023-02-03), p. 199-
    Details
    In: Journal of Fungi, MDPI AG, Vol. 9, No. 2 ( 2023-02-03), p. 199-
    Abstract: Four new species of Russula subsection Sardoninae from northern and southwestern China under coniferous and deciduous trees are proposed as R. begonia, R. photinia, R. rhodochroa, and R. rufa. Illustrations and descriptions of R. gracillima, R. leucomarginata, R. roseola, and the above four new species are provided based on evidence of morphological characters and phylogenetic analyses of the internal transcribed spacer (ITS), as well as the multi-locus of mtSSU, nLSU, rpb1, rpb2 and tef1-α. The relationships between these new species and allied taxa are discussed.
    Type of Medium: Online Resource
    ISSN: 2309-608X
    URL: Article
    DOI: 10.3390/jof9020199
    Language: English
    Publisher: MDPI AG
    Publication Date: 2023
    detail.hit.zdb_id: 2784229-0
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 4
    Online Resource
    Online Resource
    Improved Photoelectrochemical Performance of BiVO4 for Water Oxidation Enabled by the Integration of the Ni@NiO Core–Shell Structure
    MDPI AG ; 2022
    In:  Catalysts Vol. 12, No. 11 ( 2022-11-17), p. 1456-
    Details
    In: Catalysts, MDPI AG, Vol. 12, No. 11 ( 2022-11-17), p. 1456-
    Abstract: The development of highly efficient and stable photoelectrode materials is of significant importance for the conversion of solar energy into chemical fuels. Herein, a novel Ni@NiO/BiVO4 photoanode is designed and prepared for efficient water splitting by the deposition of Ni particles on the surface of BiVO4 with subsequent thermal treatment. The integration of the Ni@NiO core–shell structure can efficiently passivate the surface states and accelerate the oxygen evolution kinetics along with the in situ-generated NiOOH, consequently contributing to the significantly improved charge separation efficiency. The resulting Ni@NiO/BiVO4 photoelectrode enabled a photocurrent density of 2.6 mA/cm2 with a surface charge separation efficiency of nearly 80% at the potential of 1.23 VRHE—much better than the unmodified BiVO4 (1.8 mA/cm2, 64%).
    Type of Medium: Online Resource
    ISSN: 2073-4344
    URL: Article
    DOI: 10.3390/catal12111456
    Language: English
    Publisher: MDPI AG
    Publication Date: 2022
    detail.hit.zdb_id: 2662126-5
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 5
    Online Resource
    Online Resource
    Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression
    MDPI AG ; 2022
    In:  International Journal of Molecular Sciences Vol. 23, No. 9 ( 2022-04-30), p. 5024-
    Details
    In: International Journal of Molecular Sciences, MDPI AG, Vol. 23, No. 9 ( 2022-04-30), p. 5024-
    Abstract: With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.
    Type of Medium: Online Resource
    ISSN: 1422-0067
    URL: Article
    DOI: 10.3390/ijms23095024
    Language: English
    Publisher: MDPI AG
    Publication Date: 2022
    detail.hit.zdb_id: 2019364-6
    SSG: 12
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 6
    Online Resource
    Online Resource
    WT1-AS/IGF2BP2 Axis Is a Potential Diagnostic and Prognostic Biomarker for Lung Adenocarcinoma According to ceRNA Network Comprehensive Analysis Combined with Experiments
    MDPI AG ; 2021
    In:  Cells Vol. 11, No. 1 ( 2021-12-23), p. 25-
    Details
    In: Cells, MDPI AG, Vol. 11, No. 1 ( 2021-12-23), p. 25-
    Abstract: Lung adenocarcinoma (LUAD) is one of the most common malignancies, and there is still a lack of effective biomarkers for early detection and prognostic prediction. Here, we comprehensively analyze the characteristics of. an RNA sequencing data set of LUAD samples. In total, 395 long non-coding RNAs (lncRNAs), 89 microRNAs (miRNAs), and 872 mRNAs associated with c-Myc were identified, which were differentially expressed between tumor and normal tissues. The most relevant pathway was found to be WT1-AS–miR-200a-3p–IGF2BP2 according to the rules of competitive endogenous RNA (ceRNA) regulation. WT1-AS and IGF2BP2 expression were positively correlated and increased in LUAD samples, while miR-200a-3p had relatively low expression. The high expression of WT1-AS and IGF2BP2 was associated with poor prognosis in LUAD patients, while low expression of miR-200a-3p predicted reduced survival (p 〈 0.05). The analysis of the multi-gene regulation model indicated that the WT1-AS (downregulation)–miR-200a-3p (upregulation)–IGF2BP2 (downregulation) pattern significantly improved the survival of LUAD patients. Finally, reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting were detected in LUAD cells, and the results are consistent with the bioinformatics analysis. In summary, the WT1-AS/IGF2BP2 axis is a potential prognostic biomarker in LUAD and is expected to become an effective target for diagnosis and treatment.
    Type of Medium: Online Resource
    ISSN: 2073-4409
    URL: Article
    DOI: 10.3390/cells11010025
    Language: English
    Publisher: MDPI AG
    Publication Date: 2021
    detail.hit.zdb_id: 2661518-6
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 7
    Online Resource
    Online Resource
    Unravelling the Role of LncRNA WT1-AS/miR-206/NAMPT Axis as Prognostic Biomarkers in Lung Adenocarcinoma
    MDPI AG ; 2021
    In:  Biomolecules Vol. 11, No. 2 ( 2021-02-02), p. 203-
    Details
    In: Biomolecules, MDPI AG, Vol. 11, No. 2 ( 2021-02-02), p. 203-
    Abstract: Lung cancer is the world’s highest morbidity and mortality of malignant tumors, with lung adenocarcinoma (LUAD) as a major subtype. The competitive endogenous RNA (ceRNA) regulative network provides opportunities to understand the relationships among different molecules, as well as the regulative mechanisms among them in order to investigate the whole transcriptome landscape in cancer pathology. We designed this work to explore the role of a key oncogene, MYC, in the pathogenesis of LUAD, and this study aims to identify important long noncoding RNA (lncRNA)-microRNA (miRNA)- transcription factor (TF) interactions in non-small cell lung cancer (NSCLC) using a bioinformatics analysis. The Cancer Genome Atlas (TCGA) database, containing mRNA expression data of NSCLC, was used to determine the deferentially expressed genes (DEGs), and the ceRNA network was composed of WT1-AS, miR-206, and nicotinamide phosphoribosyltransferase (NAMPT) bashing on the MYC expression level. The Kaplan–Meier univariate survival analysis showed that these components may be closely related prognostic biomarkers and will become new ideas for NSCLC treatment. Moreover, the high expression of WT1-AS and NAMPT and low expression of miR-206 were associated with a shortened survival in NSCLC patients, which provided a survival advantage. In summary, the current study constructing a ceRNA-based WT1-AS/miR-206/NAMPT axis might be a novel important prognostic factor associated with the diagnosis and prognosis of LUAD.
    Type of Medium: Online Resource
    ISSN: 2218-273X
    URL: Article
    DOI: 10.3390/biom11020203
    Language: English
    Publisher: MDPI AG
    Publication Date: 2021
    detail.hit.zdb_id: 2701262-1
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 8
    Online Resource
    Online Resource
    NGFR Gene and Single Nucleotide Polymorphisms, rs2072446 and rs11466162, Playing Roles in Psychiatric Disorders
    MDPI AG ; 2022
    In:  Brain Sciences Vol. 12, No. 10 ( 2022-10-09), p. 1372-
    Details
    In: Brain Sciences, MDPI AG, Vol. 12, No. 10 ( 2022-10-09), p. 1372-
    Abstract: Psychiatric disorders are a class of complex disorders characterized by brain dysfunction with varying degrees of impairment in cognition, emotion, consciousness and behavior, which has become a serious public health issue. The NGFR gene encodes the p75 neurotrophin receptor, which regulates neuronal growth, survival and plasticity, and was reported to be associated with depression, schizophrenia and antidepressant efficacy in human patient and animal studies. In this study, we investigated its association with schizophrenia and major depression and its role in the behavioral phenotype of adult mice. Four NGFR SNPs were detected based on a study among 1010 schizophrenia patients, 610 patients with major depressive disorders (MDD) and 1034 normal controls, respectively. We then knocked down the expression of NGFR protein in the hippocampal dentate gyrus of the mouse brain by injection of shRNA lentivirus to further investigate its behavioral effect in mice. We found significant associations of s2072446 and rs11466162 for schizophrenia. Ngfr knockdown mice showed social and behavioral abnormalities, suggesting that it is linked to the etiology of neuropsychiatric disorders. We found significant associations between NGFR and schizophrenia and that Ngfr may contribute to the social behavior of adult mice in the functional study, which provided meaningful clues to the pathogenesis of psychiatric disorders.
    Type of Medium: Online Resource
    ISSN: 2076-3425
    URL: Article
    DOI: 10.3390/brainsci12101372
    Language: English
    Publisher: MDPI AG
    Publication Date: 2022
    detail.hit.zdb_id: 2651993-8
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 9
    Online Resource
    Online Resource
    Machine Learning-Assisted Synchronous Fluorescence Sensing Approach for Rapid and Simultaneous Quantification of Thiabendazole and Fuberidazole in Red Wine
    MDPI AG ; 2022
    In:  Sensors Vol. 22, No. 24 ( 2022-12-18), p. 9979-
    Details
    In: Sensors, MDPI AG, Vol. 22, No. 24 ( 2022-12-18), p. 9979-
    Abstract: Rapid analysis of components in complex matrices has always been a major challenge in constructing sensing methods, especially concerning time and cost. The detection of pesticide residues is an important task in food safety monitoring, which needs efficient methods. Here, we constructed a machine learning-assisted synchronous fluorescence sensing approach for the rapid and simultaneous quantitative detection of two important benzimidazole pesticides, thiabendazole (TBZ) and fuberidazole (FBZ), in red wine. First, fluorescence spectra data were collected using a second derivative constant-energy synchronous fluorescence sensor. Next, we established a prediction model through the machine learning approach. With this approach, the recovery rate of TBZ and FBZ detection of pesticide residues in red wine was 101% ± 5% and 101% ± 15%, respectively, without resorting complicated pretreatment procedures. This work provides a new way for the combination of machine learning and fluorescence techniques to solve the complexity in multi-component analysis in practical applications.
    Type of Medium: Online Resource
    ISSN: 1424-8220
    URL: Article
    DOI: 10.3390/s22249979
    Language: English
    Publisher: MDPI AG
    Publication Date: 2022
    detail.hit.zdb_id: 2052857-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
  • 10
    Online Resource
    Online Resource
    Disparate Clinical Characteristics and Prognosis of HFpEF versus HFrEF Phenotype of Diabetic Cardiomyopathy
    MDPI AG ; 2023
    In:  Journal of Clinical Medicine Vol. 12, No. 4 ( 2023-02-16), p. 1565-
    Details
    In: Journal of Clinical Medicine, MDPI AG, Vol. 12, No. 4 ( 2023-02-16), p. 1565-
    Abstract: Aims: Diabetic cardiomyopathy (DCM) is an ill-defined entity. This study aims to explore the clinical characteristics and prognosis of diabetic patients that disparately develop heart failure (HF) with preserved ejection fraction (HFpEF) other than HF with reduced ejection fraction (HFrEF). Patients and Methods: A total of 911 patients diagnosed with diabetes mellitus were identified in the ChiHFpEF cohort (NCT05278026). DCM was defined as diabetic patients diagnosed with HF, absent from flow obstructive coronary artery disease (CAD), uncontrolled refractory hypertension and hemodynamics significant heart valvular diseases, arrhythmia and congenital heart diseases. The primary endpoint was a composite of all-cause death and rehospitalization due to HF. Results: As compared to DCM-HFrEF patients, DCM-HFpEF patients had a longer duration of diabetes, were older and more noticeable in hypertension and non-obstructive CAD. After a median follow-up of 45.5 months, survival analysis showed that DCM-HFpEF patients had a better composite endpoint. Cox regression implicated that non-obstructive CAD was a negative (HR 0.101, 95% CI 0.028–0.373, p = 0.001) predictor for the composite endpoint of DCM-HFrEF patients. Age was a positive predictor for the composite endpoint of DCM-HFpEF patients (HR 1.044, 95% CI 1.007–1.082, p = 0.018). Conclusion: DCM-HFpEF is a disparate entity from DCM-HFrEF. Additional phenomic studies are needed to explore the molecular mechanisms and develop targeted therapies.
    Type of Medium: Online Resource
    ISSN: 2077-0383
    URL: Article
    DOI: 10.3390/jcm12041565
    Language: English
    Publisher: MDPI AG
    Publication Date: 2023
    detail.hit.zdb_id: 2662592-1
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
    Online Resource
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...