Abstract: Carfilzomib is a selective proteasome inhibitor that binds irreversibly to its target. In phase 1 studies, carfilzomib elicited promising responses and an acceptable toxicity profile in patients with relapsed and/or refractory multiple myeloma (R/R MM). In the present phase 2, multicenter, open-label study, 129 bortezomib-naive patients with R/R MM (median of 2 prior therapies) were separated into Cohort 1, scheduled to receive intravenous carfilzomib 20 mg/m2 for all treatment cycles, and Cohort 2, scheduled to receive 20 mg/m2 for cycle 1 and then 27 mg/m2 for all subsequent cycles. The primary end point was an overall response rate (≥ partial response) of 42.4% in Cohort 1 and 52.2% in Cohort 2. The clinical benefit response (overall response rate + minimal response) was 59.3% and 64.2% in Cohorts 1 and 2, respectively. Median duration of response was 13.1 months and not reached, and median time to progression was 8.3 months and not reached, respectively. The most common treatment-emergent adverse events were fatigue (62.0%) and nausea (48.8%). Single-agent carfilzomib elicited a low incidence of peripheral neuropathy—17.1% overall (1 grade 3; no grade 4)—in these pretreated bortezomib-naive patients. The results of the present study support the use of carfilzomib in R/R MM patients. This trial is registered at www.clinicaltrials.gov as NCT00530816.

Abstract: Abstract 3031 Background: Treatment-induced peripheral neuropathy (TIPN) can be a debilitating side-effect as well as a therapy-limiting complication in multiple myeloma (MM). Thalidomide (THAL) and bortezomib (BTZ) are two therapies frequently associated with TIPN in MM. Carfilzomib (CFZ) is a novel and highly selective epoxyketone proteasome inhibitor that differs from BTZ both structurally and mechanistically. CFZ overcomes BTZ-resistance in vitro, lacks the off-target activities of BTZ in preclinical studies, and does not cause neurotoxicity in long-term (6–9 month) chronic animal toxicology studies (Kirk et al. Blood, 2008). Single-agent CFZ produces durable responses in relapsed or refractory (R/R) MM without dose-limiting PN. Here we report on the clinical experience with single-agent CFZ in the Ph 2b PX-171-003-A1 trial in patients (pts) with R/R MM and Grade (G) 1/2 PN at study entry. Methods: Pts received CFZ at 20 mg/m2 IV, on Days 1, 2, 8, 9, 15, and 16 in a 28-day cycle (C) for the first C followed by 27 mg/m2 thereafter for up to 12 C. Pts completing 12 C were eligible to enter an extension study. Responses and progression were determined according to the International Myeloma Working Group (IMWG) criteria and were assessed by an Independent Review Committee (IRC). PN data were collected for all pts on study and included neuropathy history, neurological physical exam and PN-related quality of life data (FACT-GOG/NTx v 4.0 scores) collected at screening. Prospective neurological exams and subjective reporting of PN occurred every 2 cycles until study discontinuation to proactively assess for PN. Adverse event (AE) data were also collected, with AEs reported as ‘neuropathy peripheral', ‘neuropathic pain', ‘neuropathy', and ‘peripheral sensory neuropathy' included as PN. AE reports of ‘paraesthesias' and ‘dysesthesias' were counted separately. Results: Of the 266 pts with R/R MM in PX-171-003-A1, 237 (89%) had a history of PN which was attributable to prior anti-myeloma therapy, including THAL (108 pts/41%), BTZ (134 pts/50%), or both BTZ and THAL (17 pts/6.4%). 206 of the 266 (77%) had G1/2 PN at baseline and a median disease duration of 5.9 years. This subset with active PN at baseline had received a median of 5 prior lines of therapy (range 1–20), with a median 13 anti-myeloma agents, and a median of 2 prior BTZ- and 1 prior THAL- containing regimens. Prior therapies included 100% BTZ, and 100% either THAL (77%) or prior lenalidomide (95%). Responses in the subset of pts with baseline PN were nearly identical to those seen in the full study population with an overall response rate (ORR; ≥ partial response [PR]) of 24% and a clinical benefit response rate (CBR; ≥ minimal response [MR] ) of 36%. The median duration of response (≥PR) was 7.4 mo (95% CI 5.6–not reached) and median duration of MR was 6.3 months in both the overall and PN-baseline cohorts. OS and TTP data will also be reported. The most common treatment-emergent ≥G3 adverse events regardless of relationship to study drug were primarily hematologic and were as follows: thrombocytopenia (24%), anemia (21%), lymphopenia (11%), pneumonia (9%), neutropenia (9%), fatigue (7%), hypercalcemia (7%), and hyponatremia (6%). Although 77% of pts had G1/2 PN at baseline, new onset PN was infrequent with PN AEs of any grade reported in 31 (15%) pts and G3 PN reported in only 1 (0.4%) pt. New onset or worsening of paraesthesias (6.8%) and dysesthesias (0%) was also infrequent. Conclusions: Analysis of the subset of pts (77%) with active PN (G1/2) in this single-agent Ph 2 trial of CFZ in pts with R/R MM demonstrated that PN has no impact on depth or durability of responses, or on the tolerability of CFZ, in heavily pretreated pts with multiply relapsed and refractory MM. Reports of new or worsening PN were very uncommon, and paraesthesias and dysesthesia were generally infrequent and mild. CFZ can be given to pts with baseline PN with little risk of exacerbation; prolonged therapy is possible in this population. Disclosures: Martin: Celgene: Honoraria; Onyx: Consultancy. Singhal:Celgene: Speakers Bureau; Takeda/Millenium: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Onyx: Research Funding. Vij:Onyx: Honoraria. Wang:Celgene: Research Funding; Onyx: Research Funding; Millenium: Research Funding; Novartis: Research Funding. Stewart:Millennium: Consultancy; Celgene: Honoraria. Jagannath:Millenium, OrthoBiotec, Celgene, Merck, Onyx: Honoraria; Imedex, Medicom World Wide, Optum Health Education, PER Group: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Lonial:Millennium: Consultancy, Research Funding; Celgene: Consultancy, Research Funding; Novartis: Consultancy, Research Funding; BMS: Consultancy, Research Funding; Onyx: Consultancy, Research Funding. Jakubowiak:Millennium Pharmaceuticals, Inc.: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Consultancy, Honoraria; Centocor Ortho Biotech: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Exelixis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees. Kukreti:Celgene: Honoraria; Roche: Honoraria; Ortho Biotech: Honoraria. Alsina:Millenium: Consultancy, Research Funding; Celgene: Research Funding; Novartis: Consultancy. Zonder:Millenium: Consultancy, Honoraria, Research Funding; Cephalon: Research Funding; Celgene: Honoraria. Wong:Onyx Pharmaceuticals: Employment. Vallone:Onyx Pharmaceuticals: Employment. Chang:Onyx Pharmaceuticals: Employment. Kauffman:Onyx Pharmaceuticals: Employment. Siegel:Millenium: Consultancy, Honoraria; Celgene: Consultancy, Honoraria.

Abstract: Abstract 2865 Poster Board II-841 BACKGROUND: The ubiquitin-proteasome pathway, which has been shown to be an essential cellular degradative system in myeloma cells, can also regulate bone formation through its effects on osteoblast differentiation. Retrospective analysis of variation of ALP during treatment with bortezomib indicates a close correlation between myeloma response and serum ALP levels which multiple studies have shown to be of bone origin. To determine if this effect is a class effect of proteasome inhibitors (PIs), this retrospective study analyzed variation of ALP in relationship to myeloma response during treatment with carfilzomib, the first in a new class of selective epoxyketone PIs that has demonstrated encouraging safety and efficacy in two phase 2 studies of relapsed or refractory myeloma patients. METHODS: Retrospective analysis of serum ALP was performed on relapsed or refractory myeloma patients enrolled on two phase 2 studies (PX-171-003 and PX- 171-004) evaluating the safety and efficacy of single agent carfilzomib. We analyzed data from 38 patients in the first cohort of the PX-171-003 study, a relapsed and refractory myeloma trial for patients who have received ≥ 3 prior therapies including bortezomib and an IMiD and 29 patients in PX-171-004, a relapsed or refractory myeloma trial that included bortezomib naïve patients. All patients received 20 mg/m2 of carfilzomib on Days 1, 2, 8, 9, 15, and 16 of a 28-day cycle. RESULTS: Seventy-seven patients were enrolled. The median age was 63 years with a median time since diagnosis of 4.6 years, 52% were male, 84.% had relapsed after autologous transplants, 82.% were previously exposed to bortezomib, and 92% were previously exposed to an IMiD. Sixty seven patients with ALP data were evaluable for response. In PX-171-003 the ORR (≥PR) was 18% and the clinical benefit response (CBR; ≥MR) was 26%, while in PX-171-004 the ORR was 35.5% overall and 57% in bortezomib naive patients. ALP increment from baseline, which was most evident during the second cycle of treatment, was statistically different in patients who achieved ≥VGPR compared to all others on Days 1 (P=0.0049) and 8 (P=0.006) of Cycle 2. In all patients achieving a VGPR or better, ALP increased more than 15 units per liter at Cycle 2 Day 1 over baseline An ALP increase over the same period of time was seen in 26 %, 13%, and 11% of patients achieving PR, MR, and SD, respectively. None of the patients with progressive disease exhibited a similar increase. Our study indicates that response first assessed on Day 15 of Cycle 1 parallels the ALP elevation which returned to baseline levels at the end of Cycle 3. CONCLUSIONS: This retrospective analysis on a subset of patients in these ongoing phase 2 studies of single agent carfilzomib in relapsed or refractory multiple myeloma suggests that elevation in ALP may be associated with best response. Taken with previous publications describing bortezomib treatment, these results suggest that this specific anabolic bone phenomenon could be a class effect of proteasome inhibitors. These phase 2 studies are ongoing with a higher dose of carfilzomib (27 mg/m2) being evaluated. The data from this small subset analysis suggests that further exploration of this relationship is warranted. Disclosures: Zangari: Milllennium: Honoraria, Research Funding; Novartis: Research Funding; Celgene: Honoraria; OrthoBiotech: Honoraria; Optum Health: Honoraria; Educational Concepts Group, LLC: Membership on an entity's Board of Directors or advisory committees. Vij:Proteolix: Consultancy, Research Funding. Jagannath:Millennium: Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Honoraria; Merck: Honoraria. Siegel:Celgene: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Millennium: Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Stewart:Millennium: Consultancy, Research Funding; Proteolix: Consultancy, Honoraria; Novartis: Consultancy, Honoraria; Celgene: Honoraria. Wang:Proteolix: Honoraria, Research Funding. Belch:Ortho Biotech: Honoraria, Research Funding. Jakubowiak:Millennium Pharmaceuticals, Inc.: Consultancy, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Celgene: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Centocor Ortho Biotech: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Exelixis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Bristol-Myers-Squibb: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Trudel:Celgene: Honoraria, Speakers Bureau; Ortho Biotech: Honoraria. Bahlis:Celgene: Honoraria, Speakers Bureau; Ortho Biotech: Honoraria, Speakers Bureau. Lonial:Celgene: Consultancy; Millennium: Consultancy, Research Funding; BMS: Consultancy; Novartis: Consultancy; Gloucester: Research Funding. Singhal:Celgene: Speakers Bureau; Millennium: Speakers Bureau.

Abstract: Abstract 985 Introduction: CFZ is a novel and highly selective epoxyketone proteasome inhibitor currently in clinical development for the treatment of multiple myeloma (MM). Ph 1 and 2 studies with CFZ have demonstrated durable single-agent antitumor activity in pts with relapsed or refractory (R/R) MM. The present study, PX-171-003-A1, was an open-label, single-arm Ph 2b trial and enrolled patients with multiply relapsed MM whose disease was refractory (defined as 〈 25% response on, or progression during or 〈 60 days after completion of, therapy) to their last treatment regimen. Patients must have received ≥2 prior therapies including: 1) bortezomib (BTZ) and either thalidomide (THAL) or lenalidomide (LEN), and 2) an alkylating agent. Materials and Methods: Pts received CFZ at 20 mg/m2 on a QDx2 schedule (Days 1, 2, 8, 9, 15, and 16 every 28 days) in cycle (C) 1 and were dose escalated to 27 mg/m2 on the same schedule thereafter for up to 12 C. Pts completing 12 C were eligible to enter an extension study (PX-171-010). The primary endpoint was overall response rate (ORR) (≥ partial response [PR]). Secondary endpoints included: clinical benefit response (CBR) (ORR + Minimal response [MR] ), duration of response for ≥PR (DOR), overall survival (OS), time to progression (TTP), progression free survival (PFS), and safety. Responses and progression were determined according to the International Myeloma Working Group (IMWG) criteria and were assessed and confirmed by an Independent Response Committee (IRC). Results: 266 pts were enrolled with a median duration of MM of 5.4 years including 83% whose disease had progressed on or within 60 d of last therapy and 17% whose disease had achieved 〈 25 % response to the regimen immediately preceding study entry. Of the 266 pts enrolled pts, 257 were evaluable for response; 9 patients were considered not evaluable based on missing baseline or lacking at least one post-baseline M-protein. An ORR (≥PR) of 24% with a median DOR of 7.4 mo (range 6.2–10.3) was determined. Responses are detailed in the table. The CBR (ORR + MR) was 36%. Median DOR of pts with MRs was 6.3 months, indicating that long-term MRs were observed. An additional 32% (83 pts) achieved SD for at least 6 wks. To date, 79 pts (30%) completed ≥6 C and 〉 11% of pts have completed all 12 C of protocol specified therapy and most have entered the extension protocol; 15 pts remain on study (all 〉 10 C). OS and TTP data for the overall population will also be reported. The enrolled pts in this study were heavily pretreated having received a median of 5 prior lines of therapy (range 1–20, median of 13 anti-myeloma agents). 85% of pts had received at least 2 and 37% had received at least 3 drugs in the regimen just prior to entering the study. Prior anti-myeloma agents included 99.6% (265/266 pts) BTZ (median 2 prior regimens containing BTZ), 99.6% either THAL (74%) or LEN (94%), 98% corticosteroids, 91% alkylating agents, and 74% stem cell transplant; 65% of pts were refractory to BTZ at any point in time prior to study entry. The most common treatment-emergent adverse events ≥ Grade (G) 3 regardless of relationship to study drug were predominantly hematologic and included thrombocytopenia (22%), anemia (20%), lymphopenia (10%), pneumonia (8%), neutropenia (8%), fatigue (7%), hyponatremia (5%), and hypercalcemia (5%). Although 206 pts (77%) had G1/2 peripheral neuropathy (PN) at baseline, new onset PN was infrequent and G ≥3 PN occurred in 〈 1%. Interestingly, in this subset of patients, efficacy response was nearly identical to that seen in the full study population with an ORR (≥PR) of 24%. Conclusions: Single-agent CFZ achieved durable responses in pts with R/R MM whose disease had relapsed after all available therapies including BTZ and immunomodulatory agents. The CBR and median DOR achieved with this steroid-sparing regimen establish that CFZ has the potential to offer substantial clinical benefit to patients with relapsed or refractory disease. CFZ was well-tolerated and side effects were clinically manageable with no new or unexpected toxicities observed. Importantly, exacerbation of pre-existing PN was uncommon. Cumulative side effects were not observed, allowing prolonged single-agent dosing for chronic disease control. Disclosures: Siegel: Millenium: Consultancy, Honoraria; Celgene: Consultancy, Honoraria. Martin:Celgene: Honoraria; Onyx: Consultancy. Wang:Celgene: Research Funding; Onyx: Research Funding; Millenium: Research Funding; Novartis: Research Funding. Vij:Onyx: Honoraria. Jakubowiak:Millennium Pharmaceuticals, Inc.: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Celgene: Consultancy, Honoraria; Centocor Ortho Biotech: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Exelixis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees. Jagannath:Millenium, OrthoBiotec, Celgene, Merck, Onyx: Honoraria; Imedex, Medicom World Wide, Optum Health Education, PER Group: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Lonial:Millennium: Consultancy, Research Funding; Celgene: Consultancy, Research Funding; Novartis: Consultancy, Research Funding; BMS: Consultancy, Research Funding; Onyx: Consultancy, Research Funding. Kukreti:Celgene: Honoraria; Roche: Honoraria; Ortho Biotech: Honoraria. Alsina:Millenium: Consultancy, Research Funding; Celgene: Research Funding; Novartis: Consultancy. Zonder:Millenium: Consultancy, Honoraria, Research Funding; Cephalon: Research Funding; Celgene: Honoraria. Wong:Onyx Pharmaceuticals: Employment. Vallone:Onyx Pharmaceuticals: Employment. Chang:Onyx Pharmaceuticals: Employment. Kauffman:Onyx Pharmaceuticals: Employment. Stewart:Millennium: Consultancy; Celgene: Honoraria. Singhal:Celgene: Speakers Bureau; Takeda/Millenium: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Onyx : Research Funding.

Abstract: Continuous lenalidomide-dexamethasone (Rd)-based regimens are among the standards of care in transplant-ineligible newly diagnosed multiple myeloma (NDMM) patients. The oral proteasome inhibitor ixazomib is suitable for continuous dosing, with predictable, manageable toxicities. In the double-blind, placebo-controlled TOURMALINE-MM2 trial, transplant-ineligible NDMM patients were randomized to ixazomib 4 mg (n = 351) or placebo (n = 354) plus Rd. After 18 cycles, dexamethasone was discontinued and treatment was continued using reduced-dose ixazomib (3 mg) and lenalidomide (10 mg) until progression/toxicity. The primary endpoint was progression-free survival (PFS). Median PFS was 35.3 vs 21.8 months with ixazomib-Rd vs placebo-Rd, respectively (hazard ratio [HR] , 0.830; 95% confidence interval, 0.676-1.018; P = .073; median follow-up, 53.3 and 55.8 months). Complete (26% vs 14%; odds ratio [OR], 2.10; P & lt; .001) and ≥ very good partial response (63% vs 48%; OR, 1.87; P & lt; .001) rates were higher with ixazomib-Rd vs placebo-Rd. In a prespecified high-risk cytogenetics subgroup, median PFS was 23.8 vs 18.0 months (HR, 0.690; P = .019). Overall, treatment-emergent adverse events (TEAEs) were mostly grade 1/2. With ixazomib-Rd vs placebo-Rd, 88% vs 81% of patients experienced grade ≥3 TEAEs, 66% vs 62% serious TEAEs, and 35% vs 27% TEAEs resulting in regimen discontinuation; 8% vs 6% died on study. Addition of ixazomib to Rd was tolerable with no new safety signals and led to a clinically meaningful PFS benefit of 13.5 months. Ixazomib-Rd is a feasible option for certain patients who can benefit from an all-oral triplet combination. This trial was registered at www.clinicaltrials.gov as #NCT01850524.

Abstract: Few treatments options are available for patients (pts) with relapsed/refractory multiple myeloma (RRMM) who have previously been treated with lenalidomide (LEN) and bortezomib (BORT), and their prognosis is poor. Pomalidomide (POM) is a distinct IMiD® immunomodulatory agent with a mechanism of action consisting of direct anti-myeloma, stromal-support inhibitory, and immunomodulatory effects. In randomized phase 2 and 3 trials (MM-002 and MM-003), POM plus low-dose dexamethasone (POM+LoDEX) demonstrated marked efficacy in RRMM pts who had received multiple prior therapies, including LEN and BORT. This side-by-side analysis presents the most recent survival and safety data from these trials. Methods The MM-002 and MM-003 trials enrolled pts with ≥ 2 prior therapies, including LEN and BORT. In MM-002, pts received POM (4 mg/day on days 1–21 of each 28-day cycle) alone or in combination with LoDEX (40 mg/week). In MM-003, pts were randomized 2:1 to receive POM+LoDEX or high-dose DEX alone (HiDEX) (40 mg/days 1–4, 9–12, 17–20 in a 28-day cycle); HiDEX was chosen as the comparator to isolate the effects of POM, as at the time of trial design it was the standard salvage therapy for heavily pretreated pts. Thromboprophylaxis was required for all pts treated with POM and pts at high risk of developing venous thromboembolism. Data cutoff was February 1, 2013 for MM-002 and March 1, 2013 for MM-003. The primary endpoint in both trials was progression-free survival (PFS). Secondary endpoints included overall survival (OS), response rates, duration of response, and safety. Results In each study, pts had received a median of 5 prior therapies (range 1-17), and all pts had received prior LEN and BORT. In MM-002, 113 pts were treated with POM+LoDEX and 108 were treated with POM alone (60% of POM alone pts subsequently received DEX). A total of 79% of pts were LEN refractory; 62% were refractory to both LEN and BORT; and 35% had received LEN as their last prior therapy. With a median follow-up of 14.2 months (mos), median PFS was 4.2 mos, OS was 16.5 mos, and overall response rate (ORR, defined as at least a partial response) was 33% with POM+LoDEX (Table 1). In MM-003, 302 pts were treated with POM+LoDEX and 153 pts were treated with HiDEX (50% of HiDEX pts subsequently received POM). A total of 94% of pts were LEN refractory; 74% were both LEN and BORT refractory; and 29% had received LEN as their last prior therapy. Survival outcomes were similar in MM-003; with a median follow-up of 10 mos, median PFS was 4.0 mos, OS was 12.7 mos, and ORR was 31% with POM+LoDEX. In both trials, LEN as last prior therapy did not impact response, PFS, or OS vs the overall population. Commonly observed adverse events (AEs) are presented in Table 2 for pts treated with POM+LoDEX. Grade 3 and 4 neutropenia was 28% and 13% in MM-002, and 26% and 22% in MM-003 for the POM+LoDEX arms, respectively. AEs were generally manageable for POM+LoDEX in MM-002 and MM-003 with dose interruptions (67% for both) and reductions (29% and 26%, respectively), and standard supportive care, including growth factor support (46% and 43%), red blood cell transfusions (45% and 49%), platelet transfusions (14% and 20%), and anti-infective agents (89% in both trials). Rates of POM discontinuation due to treatment-related AEs were low (2–4% with POM+LoDEX). In MM-002 and MM-003, 49% and 51% of pts in the POM+LoDEX arms experienced neutropenia of any grade. With appropriate AE management, 9% and 23% had dose interruptions, 4% and 8% had dose reductions, and 1 pt in both MM-002 and MM-003 discontinued due to neutropenia. Febrile neutropenia developed in 3% and 10% of pts; 1% and 4% had dose interruptions, 0% and 2% had dose reductions, and no pts discontinued due to febrile neutropenia in the MM-002 and MM-003 studies, respectively. The majority of infections occurred in the absence of neutropenia of any grade (54% in MM-002 and 66% in MM-003). The rate of POM discontinuation due to infection was low (1% in MM-002 and 2% in MM-003). Conclusion In both the MM-002 and MM-003 trials, POM+LoDEX consistently extended PFS in advanced RRMM pts. PFS, OS, and ORR were not negatively impacted in patients who were refractory to LEN or BORT, even as last prior therapy. Both trials demonstrated that with dose modifications and supportive care POM was well tolerated, leading to few discontinuations. POM+LoDEX should be considered a standard of care for pts with advanced RRMM who have exhausted LEN and BORT. Disclosures: Siegel: Celgene Corporation: Honoraria, Membership on an entity’s Board of Directors or advisory committees, Speakers Bureau; Onyx: Honoraria, Membership on an entity’s Board of Directors or advisory committees, Speakers Bureau; Millennium: Honoraria, Membership on an entity’s Board of Directors or advisory committees, Speakers Bureau. Richardson:Millennium: Membership on an entity’s Board of Directors or advisory committees; Johnson & Johnson: Membership on an entity’s Board of Directors or advisory committees; Celgene Corporation: Membership on an entity’s Board of Directors or advisory committees. Dimopoulos:Celgene Corporation: Honoraria, Membership on an entity’s Board of Directors or advisory committees. Chen:Celgene Corporation: Consultancy, Honoraria, Research Funding. Song:Celgene Corporation: Honoraria, Membership on an entity’s Board of Directors or advisory committees, Research Funding, Speakers Bureau. Vij:Onyx: Consultancy, Research Funding; Millenium: Speakers Bureau; Celgene Corporation: Consultancy, Research Funding, Speakers Bureau. Bahlis:Celgene Corporation: Consultancy, Honoraria, Research Funding. Baz:Millenium: Research Funding; Bristol Myers Squibb: Research Funding; Novartis: Research Funding; Karyopharm: Research Funding; Sanofi: Research Funding; Celgene Corporation: Research Funding. Hofmeister:Celgene Corporation: Membership on an entity’s Board of Directors or advisory committees, Speakers Bureau. Weisel:Celgene Corporation: Consultancy, Honoraria, Research Funding. Jagannath:Millennium: Honoraria; Celgene Corporation: Honoraria. Lonial:Millennium: Consultancy; Novartis: Consultancy; Bristol Myers Squibb: Consultancy; Sanofi: Consultancy; Onyx: Consultancy; Celgene Corporation: Consultancy. Delforge:Celgene Corporation: Honoraria. Talpaz:Ariad, Sanofi, Novartis: Membership on an entity’s Board of Directors or advisory committees; Ariad, Novartis, BMS, Pfizer: Speakers Bureau; Ariad, BMS, Sanofi, INCYTE: Research Funding. Moreau:Celgene Corporation: Honoraria, Speakers Bureau. San Miguel:Jansen, Celgene Corporation, Onyx, Novartis, Millenium: Consultancy, Honoraria, Membership on an entity’s Board of Directors or advisory committees. Karlin:Janssen: Honoraria; Celgene Corporation: Consultancy, Expert board committee Other, Honoraria. Goldschmidt:Celgene Corporation, Janssen, Novartis: Consultancy, Honoraria, Research Funding. Oriol:Celgene Corporation: Consultancy. Alegre:Janssen: Membership on an entity’s Board of Directors or advisory committees, Research Funding; Celgene Corporation: Membership on an entity’s Board of Directors or advisory committees, Research Funding. Cavo:Millennium: Consultancy, Honoraria, Membership on an entity’s Board of Directors or advisory committees; Janssen: Consultancy, Honoraria, Membership on an entity’s Board of Directors or advisory committees; Onyx: Consultancy, Honoraria, Membership on an entity’s Board of Directors or advisory committees; Bristol-Myers Squibb: Consultancy, Honoraria, Membership on an entity’s Board of Directors or advisory committees; Celgene Corporation: Consultancy, Honoraria, Membership on an entity’s Board of Directors or advisory committees. Martinez-Lopez:Celgene Corporation: Honoraria, Research Funding. Lacy:Celgene Corporation: Research Funding. Chen:Celgene Corporation: Employment, Equity Ownership. Casey:Celgene Corporation: Employment, Equity Ownership. Sternas:Celgene Corporation: Employment, Equity Ownership. Zaki:Celgene Corporation: Employment, Equity Ownership. Jacques:Celgene Corporation: Employment, Equity Ownership. Anderson:Onyx: Consultancy, Equity Ownership; Gilead: Consultancy, Equity Ownership; sanofi aventis: Consultancy, Equity Ownership; Oncopep: Consultancy, Equity Ownership; Acetylon: Consultancy, Equity Ownership; Celgene Corporation: Consultancy, Equity Ownership.

Abstract: BCL2 family members such as MCL1, BCLXL, and BCL2 are critical for cancer cell survival and therefore represent promising therapeutic targets. Both B cells and CLL cells depend primarily on BCL-2 and are thus sensitive to the BCL2 specific inhibitor venetoclax, while plasma cells and multiple myeloma typically depend on Mcl-1 and would therefore be resistant to venetoclax. However, a subset of myeloma is venetoclax sensitive based on recent in vitro and clinical trial data. In preliminary results from a phase I trial of venetoclax in multiple myeloma, 40% of patients positive for t(11;14) had objective responses, while only 6% of t(11;14) negative patients responded. We have made similar observations with in vitro testing of 30 freshly isolated myeloma patient samples, identifying both non-t(11;14) samples sensitive to venetoclax as well as resistant t(11;14) positive samples. Together, these results suggest not only that a subset of multiple myeloma is co-dependent on BCL2 but also that t(11;14) is neither necessary nor sufficient for responding to venetoclax. We therefore set out to identify other factors that may predict BCL2 dependence in multiple myeloma. Previous studies of t(11;14) myeloma have noted increased expression of CD20, CD23, CD79a, and PAX5 which are typically associated with B cells prior to their differentiation into plasma cells. Based on these observations we hypothesized that venetoclax sensitivity in myeloma may be associated with the retention of B cell properties including BCL2 dependence. We probed an online expression database of myeloma cell lines for non-t(11;14) cell lines expressing CD20 and identified two cell lines, OCI-My5 and PCM6, both of which we found to have an IC50 of approximately 50nM when treated with venetoclax. We went on to characterize a panel of 13 cell lines. In addition to OCI-My5 and PCM6, 4 other cell lines were sensitive to venetoclax, all positive for t(11;14). Of the 7 venetoclax resistant cell lines, 2 were t(11;14) positive. Protein levels of MCL1, BCLXL, and BCL2 were comparable among the 13 lines and therefore anti-apoptotic expression is unlikely to be responsible for venetoclax sensitivity. Consistent with our previous co-immunoprecipitation studies, more of the pro-apoptotic BIM was bound to BCL2 in venetoclax sensitive lines compared to resistant lines. In the absence of differences in BCL2 family expression, we next sought to identify other B cell related features correlating with venetoclax sensitivity. We used RNAseq data from our 13 cell lines to compare the expression of 100 genes previously reported to be differentially expressed between normal B cells and plasma cells. Interestingly, unsupervised clustering revealed a group of venetoclax sensitive cells enriched for other B cell associated genes. GSEA revealed enrichment of genes associated with immune system activation at a p 〈 0.001. We also analyzed the differential expression of genes between our sensitive and resistant lines and again identified overexpression of B cell related genes such as CD20, CD79A, STAT5A, and RASGRP2 in venetoclax sensitive lines, though no single marker was present in all of the venetoclax sensitive lines. We examined the expression of CD20, CD79a, and CD79b in the CoMMpass data set (IA8) as well and found that they were not co-expressed in most patients, again suggesting that no single marker is likely to be predictive. Finally, we created a gene signature from the top differentially expressed genes to predict sensitivity or resistance to venetoclax and used this signature to evaluate a database of 68 myeloma cell lines. One of the top hits predicted to be sensitive by our gene signature is the t(11;14) negative line MOLP2, and indeed this cell line was recently reported to be highly responsive to venetoclax. In conclusion, B cell markers and our gene signature correlate with BCL2 dependence and venetoclax sensitivity independent of t(11;14). Disclosures Bahlis: BMS: Honoraria; Onyx: Consultancy, Honoraria; Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Amgen: Consultancy, Honoraria. Nooka:Spectrum, Novartis, Onyx pharmaceuticals: Consultancy. Kaufman:Pharmacyclics: Consultancy; Incyte: Consultancy; Novartis: Consultancy, Research Funding; Celgene: Consultancy, Research Funding. Lonial:Onyx: Consultancy; Onyx: Consultancy; BMS: Consultancy; Janssen: Consultancy; Merck: Consultancy; Celgene: Consultancy; Novartis: Consultancy; Millenium: Consultancy; BMS: Consultancy; Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy.

Abstract: Background: IMiDs neomorphe the substrates binding of CRL4_DDB1_ROC1 E3 ligase through their interaction with the adaptor protein Cereblon (CRBN) triggering the proteasomal degradation of IKZF1/IKZF3. This binding results from hydrogen bonds forming between the carbonyl residues of the IMiDs' glutarimide moiety and several amino acids within a hydrophobic pocket on the surface of CRBN. This pocket is formed by three tryptophan residues (W380, W386 and W400) mapping to CRBN c-terminus exons 10-11. Others and us, have previously shown that in vitro silencing or knock-out of CRBN is clearly associated with resistance to IMiDs, however CRBN mutations mapping to its thalidomide binding domain are rarely seen. We have previously identified through paired sequencing of the transcriptome of primary myeloma cells (pre- and post IMiDs) the expression of a CRBN mRNA splice variant (CRBN-005 or ENST00000424814) lacking exon 10. We also demonstrated that this isoform is translated into a stable protein that retains its binding to DDB1/Cul4a ligase but was no longer capable of interacting with IMiDs. Functionally, in HEK293 we have also shown that stable expression of CRBN-005 at higher levels relative to the full-length variant (CRBN-004 or ENST00000231948) abrogated IMiDs-induced degradation of Ikaros. In the current work, we validated in myeloma cell lines in vitro that the splicing of CRBN exon 10 was sufficient to reverse the cytotoxicity of lenalidomide. We also interrogated the longitudinal CoMMpass trial for the expression of CRBN-005 transcripts and its impact on survival. Methods and Results: We initially confirmed that lentiviral CRISPR mediated stable knock-out of CRBN using gRNA targeting exon 2 in the MM1S and OPM2 lenalidomide sensitive cell lines, resulted in complete resistance to IMiDs. In order to examine the role of CRBN exon 10 splicing in IMiDs resistance, we next cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into lentiviral plasmid pLX304 and stably transduced JJN3 and KMS28BM myeloma cells. The Δ10-CRBN plasmid expressed a ~ 45 kDa proteins detectable by western blotting with CRBN65 antibody (Celgene, binds aa 65-76). Stable expression of Δ10-CRBN in JJN3 and KMS28BM cells significantly reduced Aiolos and Ikaros degradation in response to lenalidomide treatment and partially reversed (~ 30%) KMS28BM cell death (JJN3 are resistant to lenalidomide despite IKZF1 degradation). Consistent with our previous studies in HEK293 cells, high expression of Δ10-CRBN relative to endogenous WT-CRBN was required for the reversal of lenalidomide effects. Furthermore, we used the CRIPSR technology to induce splicing of endogenous CRBN exon 10 using two lentiviral gRNAs targeting intron9-exon10 (TTTATCCTTATGTGGGCCGA) and exon10-intron10 junctions (CAGAACACAGCTGGTTTCCT) in lenalidomide-sensitive MM1S and OPM2 cells stably engineered to express Cas9. Single cell clones expressing the exon 10 spliced CRBN were identified by cDNA cloning and sanger sequencing. The viability of the clones in response to lenalidomide as well as Ikaors degradation were nearly fully reversed in comparison to Cas9 only expressing MM1S and OPM2 cells. Lastly, in order to clinically validate the role of Δ10-CRBN in IMiDs resistance we interrogated the transcriptome of patients enrolled in the CoMMpass trial where in addition to genomic profiling (shallow genome long-insert sequencing, WES, RNAseq) clinical data and outcomes are captured. In the CoMMpass IA8, clinical and molecular data is available on 549 subjects, of which 486 were identified as ever receiving IMiDs-based regimen. We analyzed the survival of these patients based on the ratio of transcript levels (TPM) of spliced CRBN (ENST00000424814) to that of full-length CRBN. Using a cut-off ratio of 0.75, the survival of patients treated with IMiDs based regimen and high levels of spliced CRBN was significantly worse (Figure). Importantly, in 20 patients were RNA was available pre- and post IMiDs, we show that the levels of the CRBN spliced variants were significantly increased at the time of disease progression (Figure boxplot). Conclusions: In the current work, we have confirmed the role CRBN exon 10 splicing in IMiDs resistance using functional in vitro validation studies and demonstrated its predictive effects on IMiDs activity in the CoMMpass clinical dataset. Figure Figure. Disclosures Neri: Celgene and Jannsen: Consultancy, Honoraria. Lonial:Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy; Janssen: Consultancy; Celgene: Consultancy; Millenium: Consultancy; BMS: Consultancy; Novartis: Consultancy; BMS: Consultancy; Merck: Consultancy; Onyx: Consultancy; Onyx: Consultancy. Bahlis:Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Onyx: Consultancy, Honoraria; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; BMS: Honoraria; Amgen: Consultancy, Honoraria.

Abstract: Background: Ricolinostat, an oral selective HDAC6 inhibitor, is well tolerated as monotherapy (Raje Blood 2012;120:4061) and demonstrates potent synergistic activity with lenalidomide (Len) and pomalidomide (Pom) in preclinical models (Quayle Blood 2013;122:1952). In an ongoing trial of ricolinostat in combination with Len and dexamethasone (Dex) in patients with relapsed or refractory multiple myeloma (MM), no dose limiting toxicities (DLTs) were observed at up to doses of 160 mg BID, with excellent activity and tolerability (Yee Blood 2014;124:4772). Pan-HDAC inhibitors vorinostat and panobinostat are active in MM in combination with bortezomib (Btz) and Len, but toxicities (thrombocytopenia, fatigue, and GI events) limit dosing exposure. This trial explores activity of ricolinostat in combination with Pom and Dex in a patient population comparable to that in MM-003 (San Miguel Lancet Oncol 2013;14:1055-66). At the time of achieving the primary endpoint of PFS in MM-003, the ORR was 16.6% at 18.1 weeks median follow-up (EMA Pom Celgene Assessment Report EMA/CHMP/427059/2013), and was 31% at 10 months in the same clinical trial (San Miguel Lancet Oncol 2013;14:1055-66). Methods: Phase 1b was a 3+3 design which explored ricolinostat 160 mg QD or BID combined with Pom (4 mg) for 21 days of a 28 day cycle with Dex (40 mg) on days 1, 8, 15 and 22. Patients had measurable disease, adequate BM reserve and hepatic function with CrCl ≥45 mL/min. Refractory was defined as PD on or within 60 days of last therapy. Patients with non-secretory MM, prior Pom or HDAC inhibitor therapy were excluded. Peripheral blood samples were obtained for PK/PD assessment of acetylated tubulin and histones. Patients with serum FLC only disease were excluded from Phase 2. The dose level of 160 mg dose was chosen based on prior experience in which PK plateau was reached at 160 mg of ricolinostat. A sample size of 66 was determined to be adequate to detect an ORR of 44% against a historical rate of 29%. Results: 7 patients were treated in phase 1b: 3 at 160 mg QD and 4 at 160 mg BID. No DLTs were observed; however, all 4 patients had grade 2 diarrhea in the 160 mg BID cohort and grade 3 fatigue and grade 3 or 4 neutropenia attributed to Pom were reported in patients in phase 1b. 1 patient remained on study for 12 cycles before PD; the other 6 Phase 1b patients were withdrawn for PD at 2-4 cycles. Following safety review committee (SRC) review, phase 2 opened at a dose of 160 mg BID, with a predetermined SRC review to occur after 6 patients had completed 1 cycle of therapy. 3 of the 6 patients had clinically relevant diarrhea requiring ricolinostat dose reduction to 160 mg QD in cycle 2 leading to SRC recommendation of QD dosing of ricolinostat. As of April 28, 2015 39 phase 2 patients were evaluable for safety and 28 evaluable for response. Median age was 68 and median number of prior regimens was 4 (2-9) in 3 (2-6) line of therapy. 37 patients were refractory to Len as defined in the entry criteria. Common toxicities were predominantly low grade and included fatigue (40%), diarrhea (38%), neutropenia (36%), anemia (31%), thrombocytopenia (26%), and constipation (21%). Important grade 3/4 related toxicities included neutropenia (5 patients, 13%) and diarrhea (3 patients, 8%). PK of ricolinostat was similar to that observed in combination with Btz and Len. There was no evidence of ricolinostat accumulation or drug-drug interaction with Pom. Median follow-up of 12 (4-32) weeks; ORR (≥PR) was 29% with 3 VGPR and clinical benefit rate (≥MR) was 50% with 68% SD or better for the 28 response evaluable patients. Updated safety and efficacy data will be presented as enrollment continues and data matures including for the 49 patients enrolled in phase 2 to date. Conclusion: These early data with a median follow-up of 12 weeks (compared to historical control of 16.6% ORR at 18.1 weeks for Pom/Dex alone in MM-003) in a rigorously defined patient population suggest that selective HDAC6 inhibition is associated with encouraging tolerability and promising clinical activity. Accrual is continuing in US, Canada, and Europe. Overall, ricolinostat is an active and safe oral agent which combines favorably with Pom and Dex in relapsed-and-refractory MM. Disclosures Raje: Novartis: Consultancy; Takeda: Consultancy; Amgen: Consultancy; Eli Lilly: Research Funding; AstraZeneca: Research Funding; Millenium: Consultancy; Onyx: Consultancy; Acetylon: Research Funding; Celgene Corporation: Consultancy; BMS: Consultancy. Bensinger:Sanofi: Research Funding; Acetylon Pharmaceuticals, Inc: Research Funding; BMS: Research Funding; Novartis: Research Funding; Novartis: Membership on an entity's Board of Directors or advisory committees; BMS: Membership on an entity's Board of Directors or advisory committees; Celgene: Research Funding; Celgene: Membership on an entity's Board of Directors or advisory committees; Millenium: Research Funding; Onyx: Research Funding; Sanofi: Membership on an entity's Board of Directors or advisory committees. Lonial:Celgene: Consultancy, Research Funding; Janssen: Consultancy, Research Funding; Novartis: Consultancy, Research Funding; Bristol-Myers Squibb: Consultancy, Research Funding; Millennium: Consultancy, Research Funding; Onyx: Consultancy, Research Funding. Jagannath:BMS: Honoraria; Novartis Pharmaceuticals Corporation: Honoraria; Janssen: Honoraria; MERCK: Honoraria; Celgene: Honoraria. Valent:Takeda/Millennium: Speakers Bureau; Celgene: Speakers Bureau. Harb:Idera Pharmaceuticals: Research Funding; Astex Pharmaceuticals, Inc.: Research Funding. Sandhu:Janssen: Consultancy, Honoraria; Novartis: Consultancy, Honoraria; Amgen: Consultancy, Honoraria; Celgene: Consultancy, Honoraria. Bahlis:Johnson & Johnson: Research Funding; Johnson & Johnson: Speakers Bureau; Johnson & Johnson: Consultancy; Amgen: Consultancy; Celgene: Consultancy, Honoraria, Research Funding, Speakers Bureau. Reece:Merck: Research Funding; Lundbeck: Honoraria; Amgen: Honoraria; Onyx: Consultancy; Novartis: Honoraria, Research Funding; Bristol-Myers Squibb: Research Funding; Janssen-Cilag: Consultancy, Honoraria, Research Funding; Celgene: Consultancy, Honoraria, Research Funding; Millennium Takeda: Research Funding; Otsuka: Research Funding. Terpos:Janssen: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Travel expenses; Takeda: Honoraria; Celgene: Honoraria, Other: Travel expenses; Novartis: Honoraria; Amgen: Honoraria, Other: Travel expenses, Research Funding. Tamang:Acetylon Pharmaceuticals, Inc.: Employment. Jones:Acetylon Pharmaceuticals, Inc.: Employment, Equity Ownership. Wheeler:Acetylon Pharmaceuticals, INC: Employment. Markelewicz:Acetylon Pharmaceuticals, Inc: Employment. Richardson:Celgene: Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Membership on an entity's Board of Directors or advisory committees; Novartis: Membership on an entity's Board of Directors or advisory committees; Millennium Takeda: Membership on an entity's Board of Directors or advisory committees; Johnson & Johnson: Membership on an entity's Board of Directors or advisory committees.

Abstract: Abstract 634 Background: Pts with relapsed/refractory multiple myeloma (RRMM), resistant to LEN and BORT, have poor outcomes. POM (2 or 4 mg/d for 28 d of each 28-d cycle) is an immunomodulatory compound with activity in pts refractory to both LEN and BORT (Lacy MQ et al. Blood 2011;doi:10.1182). This multicenter phase 1/2 study investigated the safety and efficacy of POM alone or in combination with LoDex (POM+LoDex) for treatment of pts with RRMM who had received both BORT and LEN. Phase 1 identified 4 mg/d of POM as the recommended dose for phase 2 (Richardson PG et al. Blood 2010;116:Abs 864). Phase 2 results are presented. Methods: Pts with RRMM after ≥ 2 prior regimens, including ≥ 2 cycles of LEN and BORT separately or in combination, were eligible. Pts had to have progressed ≤ 60 d of their last treatment prior to study entry (refractory disease). This analysis evaluated the efficacy and safety of POM+LoDex (POM 4 mg/d 1–21 d of each 28-d cycle; Dex 40 mg/wk) and POM alone in a randomized open-label study. Results presented here were based on investigator assessed responses for the intent-to-treat population. Responses were independently adjudicated. The primary endpoint was progression-free survival (PFS). Secondary endpoints were objective response (partial response [PR] or ≥ PR), duration of response (DOR), overall survival (OS), and safety. All pts received daily low-dose aspirin thromboprophylaxis. Results: A total of 221 pts were enrolled in phase 2 (POM+LoDex n = 113; POM n = 108); 219 received ≥ 1 cycle of study treatment and 191 pts were evaluable for response. Baseline characteristics were comparable between the two arms with a median of 5 (range 2–13) prior therapies in both arms; 74% of pts in POM+LoDex and 76% of pts in POM alone had prior autologous stem-cell transplantation (ASCT). The remaining pts were elderly (aged 〉 75 yrs) or ineligible for ASCT; all pts were exposed to corticosteroids and 84% in the POM+LoDex and 95% in POM alone arms were exposed to alkylators. Pts were refractory to LEN (POM+LoDex 77% and POM alone 79%), BORT (73% and 69%), or both drugs (61% and 59%). Among pts who were randomized to receive POM alone, 61 (56%) subsequently went on to receive POM+LoDex due to progressive disease (PD) per protocol. A median of 5 (range 1–17) treatment cycles were received by pts in both arms. Median treatment duration was 5.0 mos. Response of ≥ PR was seen in 34% of pts in the POM+LoDex arm and 13% in the POM alone arm, including 1% complete response (CR) in each arm; ≥ minor response (MR) was 45% vs 29%, respectively. Median DOR was 7.7 mos with POM+LoDex and 8.3 mos with POM alone, and median PFS was 4.6 mos and 2.6 mos, respectively (Fig 1). Median OS was comparable for both arms (14.4 and 13.6 mos). Results from independent adjudication were similar, with ≥ PR in 30% of pts in the POM+LoDex arm and 9% in the POM alone arm, including 1% and 0% CR, respectively, in each arm. ≥ MR was achieved with POM+LoDex in 45% and with POM alone in 25%; PFS was 3.8 mos and 2.5 mos, respectively. In the subgroup of pts refractory to both LEN and BORT, 30% and 16% of pts treated with POM+LoDex or POM alone, respectively, achieved ≥ PR; ≥ MR was 45% and 30%, respectively. Median PFS was 3.8 mos for POM+LoDex and 2.0 mos for POM alone; median OS showed a similar trend (13.5 and 10.8 mos, respectively). The main reason for treatment discontinuation was PD in both arms (POM+LoDex 51%; POM alone 44%); discontinuations due to adverse events (AEs) were 7% and 12%, respectively. Grade 3/4 AEs in POM+LoDex vs POM alone, respectively, were: neutropenia 38% and 47%; febrile neutropenia 2% and 2%; thrombocytopenia 19% and 21%; anemia 21% and 17%; pneumonia 19% and 8%; and fatigue 10% and 8%. All grades of peripheral neuropathy, deep vein thrombosis, and renal failure occurred in 7% and 10%, 2% and 1%, and 2% and 1% of pts for POM+LoDex vs POM alone, respectively. Conclusions: POM (4 mg/d 1–21 d of each 28-d cycle) with or without LoDex demonstrates clinical activity and is generally well tolerated in pts with advanced MM who have received multiple prior therapies and are refractory to both LEN and BORT. Prospective comparison indicates that POM+LoDex is associated with greater clinical benefit and no increased toxicity vs POM alone. This is supported by high response rates, long DOR, and PFS benefit achieved with POM+LoDex. The regimen is now being investigated both in phase 3 trials, and as part of combination treatment including with BORT. Disclosures: Richardson: Millennium Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Celgene Corporation: Membership on an entity's Board of Directors or advisory committees; Novartis Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Johnson & Johnson: Membership on an entity's Board of Directors or advisory committees; Bristol Myers Squibb: Membership on an entity's Board of Directors or advisory committees. Off Label Use: Pomalidomide is a new treatment for multiple myeloma. Siegel:Celgene Corporation: Honoraria, Research Funding, Speakers Bureau. Vij:Celgene: Consultancy, Research Funding, Speakers Bureau. Jagannath:PER Group: Honoraria; J & J Pharm: Membership on an entity's Board of Directors or advisory committees; Envision Communication: Honoraria, Membership on an entity's Board of Directors or advisory committees; Imedex: Honoraria; Dava Oncology: Membership on an entity's Board of Directors or advisory committees; Merck Sharp & Dohme: Investigators meeting; Celgene Corporation: Honoraria, Membership on an entity's Board of Directors or advisory committees; Jansen Pharmaceuticals: Honoraria; Medicom Worldwide: Membership on an entity's Board of Directors or advisory committees. Chen:Celgene Corporation: Consultancy, Honoraria, Research Funding. Lonial:Celgene Corporation: Consultancy; Millennium Pharmaceuticals: Consultancy; Novartis: Consultancy; Bristol-Myers Squibb: Consultancy; Onyx: Consultancy; Merck: Membership on an entity's Board of Directors or advisory committees. Jakubowiak:Ortho Biotech: Consultancy, Honoraria, Speakers Bureau; Celgene Corporation: Consultancy, Honoraria, Speakers Bureau; Millennium Pharmaceuticals: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Onyx Pharmaceuticals: Consultancy, Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees; Exelixis: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees. Bahlis:Celgene Corporation: Consultancy, Honoraria, Research Funding, Speakers Bureau. Baz:BMS: Research Funding; Millennium: Research Funding; Celgene Corporation: Membership on an entity's Board of Directors or advisory committees, Research Funding; Novartis: Research Funding. Larkins:Celgene Corporation: Employment. Chen:Celgene Corporation: Employment. Zaki:Celgene Corporation: Employment. Anderson:Acetylon Pharmaceuticals: Consultancy, Equity Ownership; Celgene Corporation: Membership on an entity's Board of Directors or advisory committees; Novartis Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Millennium Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Onyx: Membership on an entity's Board of Directors or advisory committees; Bristol-Myers Squibb: Membership on an entity's Board of Directors or advisory committees; Merck: Membership on an entity's Board of Directors or advisory committees.