GLORIA

GEOMAR Library Ocean Research Information Access

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • American Society of Hematology  (1)
  • Liu, Xin  (1)
  • 2010-2014  (1)
Material
Publisher
  • American Society of Hematology  (1)
Person/Organisation
Language
Years
  • 2010-2014  (1)
Year
Subjects(RVK)
  • 1
    Online Resource
    Online Resource
    American Society of Hematology ; 2012
    In:  Blood Vol. 120, No. 21 ( 2012-11-16), p. 1544-1544
    In: Blood, American Society of Hematology, Vol. 120, No. 21 ( 2012-11-16), p. 1544-1544
    Abstract: Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    RVK:
    RVK:
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2012
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...