GLORIA

GEOMAR Library Ocean Research Information Access

Language
Preferred search index
Number of Hits per Page
Default Sort Criterion
Default Sort Ordering
Size of Search History
Default Email Address
Default Export Format
Default Export Encoding
Facet list arrangement
Maximum number of values per filter
Auto Completion
Topics (search only within journals and journal articles that belong to one or more of the selected topics)
Feed Format
Maximum Number of Items per Feed

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
Filter
  • American Society of Hematology  (1)
  • Liu, Xin  (1)
  • 2010-2014  (1)
Material
Publisher
  • American Society of Hematology  (1)
Person/Organisation
Language
Years
  • 2010-2014  (1)
Year
Subjects(RVK)
  • 1
    Online Resource
    Online Resource
    American Society of Hematology ; 2012
    In:  Blood Vol. 120, No. 21 ( 2012-11-16), p. 1544-1544
    In: Blood, American Society of Hematology, Vol. 120, No. 21 ( 2012-11-16), p. 1544-1544
    Abstract: Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.
    Type of Medium: Online Resource
    ISSN: 0006-4971 , 1528-0020
    RVK:
    RVK:
    Language: English
    Publisher: American Society of Hematology
    Publication Date: 2012
    detail.hit.zdb_id: 1468538-3
    detail.hit.zdb_id: 80069-7
    Location Call Number Limitation Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...