GLORIA

GEOMAR Library Ocean Research Information Access

Ihre E-Mail wurde erfolgreich gesendet. Bitte prüfen Sie Ihren Maileingang.

Leider ist ein Fehler beim E-Mail-Versand aufgetreten. Bitte versuchen Sie es erneut.

Vorgang fortführen?

Exportieren
Filter
  • American Society of Hematology  (1)
  • Liu, Xin  (1)
  • 2010-2014  (1)
Materialart
Verlag/Herausgeber
  • American Society of Hematology  (1)
Person/Organisation
Sprache
Erscheinungszeitraum
  • 2010-2014  (1)
Jahr
Fachgebiete(RVK)
  • 1
    Online-Ressource
    Online-Ressource
    American Society of Hematology ; 2012
    In:  Blood Vol. 120, No. 21 ( 2012-11-16), p. 1544-1544
    In: Blood, American Society of Hematology, Vol. 120, No. 21 ( 2012-11-16), p. 1544-1544
    Kurzfassung: Abstract 1544 Introduction: Diffuse large-B-cell lymphoma (DLBCL) is known as an aggressive malignancy arising from B lymphocytes. Despite its greatly improved prognosis as a result of chemotherapy and immunotherapy with monoclonal antibodies, the exact molecular etiology of DLBCL is not well understood. Interleukin-9 (IL-9) is initially described as a growth factor secreted by activated Th2 cells. Various observations have demonstrated its diverse actions in immune disorders. Recent years, the determination of its growth-proliferative and anti-apoptotic activities on multiple transformed cells implies a potential role of this cytokine in tumorigenesis but there are still no reports about its oncogenic activities in DLBCL. Our study is aimed to test the expression of IL-9 and its receptor (IL-9R) in DLBCL patients and illustrate its pathogenic effect on DLBCL cell lines in vitro. Methods: Blood samples and araffin-embedded tissues from twenty DLBCL patients were collected prior to therapeutic interventions. Serums from healthy volunteers served as normal control. IL-9 levels in sera were quantified using human ELISA kits. The expression of IL-9R protein in DLBCL tissues and lymphoma cell lines (LY1, LY8, SP53, Mino and Jurket) was determined by immunohistochemical staining and western-blot, respectively. IL-9R genes were knocked down in DLBCL cell lines LY1 and LY8 by lentivirus-mediated gene silencing (interference sequence 5'- GCTCGTGCCATCTGACAATTT -3'). LY1, LY8 and the stable transfected cells were treated with IL-9 alone and in synergy with rituximab (10ug/ml). Disclosures: No relevant conflicts of interest to declare.
    Materialart: Online-Ressource
    ISSN: 0006-4971 , 1528-0020
    RVK:
    RVK:
    Sprache: Englisch
    Verlag: American Society of Hematology
    Publikationsdatum: 2012
    ZDB Id: 1468538-3
    ZDB Id: 80069-7
    Standort Signatur Einschränkungen Verfügbarkeit
    BibTip Andere fanden auch interessant ...
Schließen ⊗
Diese Webseite nutzt Cookies und das Analyse-Tool Matomo. Weitere Informationen finden Sie hier...